We narrowed to 120 results for: REP
-
TypeCollection...cloning grade DNA order? For each cloning grade DNA prep, the plasmid sequence has been validated by next...guarantee that Addgene will make cloning grade DNA preps of this plasmid available, but helps to inform us...
-
Plasmid Collections
TypeCollection...Collections Addgene Plasmid Collections Addgene's repository contains 162,996 plasmids . We've gathered our...looking for a non-plasmid item, browse our entire repository . Plasmid Resources Our curated resources group... -
Optogenetics Plasmid Collection
TypeCollection... terms. Looking for viral preps? We also offer ready-to-use AAV preparations of many optogenetics plasmids... -
CRISPR Plasmids - gRNAs
TypeCollection...Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts The...sequences within exons, whereas CRISPR activation or repression experiments use targets within promoters. Do ... -
Chemogenetics Plasmids
TypeCollection... terms. Looking for viral preps? We also offer ready-to-use AAV preparations of many chemogenetics plasmids... -
CRISPR Plasmids and Resources
TypeCollection...Addgene's Viral Service : Request ready-to-use viral preps of select CRISPR lentiviral plasmids. CRISPR Plasmid...expression. Interfere dCas9 alone, or fused to a repressor peptide, inhibits transcription. Epigenetics dCas9... -
CRISPR Plasmids - Base Edit
TypeCollection...Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts Two...subsequently converted to thymidine through base excision repair, creating a C to T change (or a G to A on the opposite... -
AAV Molecular Tools
TypeCollection...eligible AAV plasmids and we’ll make the viral vector prep you need. Or fill out our form to let us know what...what you would like to see available in viral prep format. Please note this does not guarantee viral vector... -
Plant Plasmids and Resources
TypeCollection...Proteins Other Resources Background Addgene’s repository contains many plasmid tools that were specifically...a new window) - The ABRC collects, preserves, reproduces, and distributes diverse seed and other stocks... -
p53 Pathway
TypeCollection...CHK2 Checkpoint kinase 2 Cop-1 Ring finger and WD repeat domain 2 (RFWD2); E3 ubiquitin protein ligase cytoC...and tensin homolog PUMA BCL2 binding component 3 Reprimo TP53 dependent G2 arrest mediator candidate Scotin... -
Kazuhiro Oka Lentiviral Vectors
TypeCollection...set of lentiviral transfer vectors you can find reporter plasmids to test whether or not you've efficiently...to generate adenovirus expressing a variety of reporters as well as the Cre and Flp recombinases. Genes... -
Penn Vector Core Partnership with Addgene
TypeCollection... to provide AAV viral preps, includes listing of transfer status for viral preps.... -
Validated gRNA Sequences
TypeCollection...sequences within exons, whereas CRISPR activation or repression experiments use targets within promoters. When...pyogenes 23929339 Sheen pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate ... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts CRISPR... II-A CRISPR arrays capable of simultaneously repressing multiple target genes in Escherichia coli. Koffas... -
Neuroscience
TypeCollection...responsibility of the authors and does not necessarily represent the official views of the National Institutes ... -
Synthetic Biology - Networks and Gene Regulation
TypeCollection.... Examples Include: promoters and terminators repressors and activators logic gates Networks and Gene ... -
CRISPR Plasmids - dCas9-FokI
TypeCollection...Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts A ... -
Synthetic Biology - Cloning and Genomic Tools
TypeCollection...systems. Jump to Table: Cloning and Genomic Tools Reporters and Tags Library Construction Integration Recombination... -
Antibodies
TypeCollection...are expressed and purified from plasmids in our repository.... -
KLF Research Plasmids
TypeCollection... to mediate transcriptional activation and/or repression. Continuing collaborative efforts within the ...