We narrowed to 14,447 results for: cas9 genes
-
Plasmid#104819PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-2). Also expresses Cas9 from Gmubi promoter.DepositorInsertGlyma.04g057400
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC29
Plasmid#104803PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr4g094545 (Hen1). Also expresses Cas9 from Gmubi promoter.DepositorInsertMedtr4g094545
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHDR-USR-eGFP
Plasmid#208830PurposeHDR Universal Surrogate Reporter with a sgRNA and consistently expressed eGFP but without Cas9. The selective PuroR reporter gene was designed to be repaired only by the sgRNA/Cas9-triggered HDR.DepositorTypeEmpty backboneExpressionMammalianPromoterCMV, U6Available SinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
TLCV2
Plasmid#87360PurposeLentiCRISPR v2 was modified into an all-in-one dox inducible system. The addition of doxycycline induces Cas9-2A-eGFP. The U6 promoter drives constitutive sgRNA expression.DepositorHas ServiceCloning Grade DNAInsertCas9-2A-eGFP
UseCRISPR and Lentiviral; Doxycycline inducible; egf…TagsCas9-T2A-eGFPExpressionMammalianPromoterTight TRE promoterAvailable SinceFeb. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpCTRE-CD4
Plasmid#114010PurposeDox-inducible Cas9 expression with a CD4 selection markerDepositorInsertSpCas9
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
AIO-Puro
Plasmid#74630PurposeAll-in-One plasmid encoding dual U6 promoter-driven sgRNAs and Cas9-D10A nickase linked via 2A peptide with puromycin resistant marker to enhance efficient and accurate genome editingDepositorTypeEmpty backboneUseCRISPRTagsPuromycin resistant markerExpressionMammalianPromoterCbhAvailable SinceMay 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSP1673
Plasmid#65769PurposeBacterial expression plasmid for S. thermophilus1 Cas9 & sgRNA (need to clone in spacer into BspMI sites): T7-humanSt1Cas9-NLS-T7-BspMIcassette-St1-sgRNADepositorInsertmammalian codon-optimized Streptococcus thermophilus1 Cas9-NLS, and St1Cas9 gRNA
UseCRISPRTagsNLSExpressionBacterialPromoterT7 (x2)Available SinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
Non-specific sgRNA
Plasmid#109432PurposeMLM3636 backbone containing a gRNA that does not bind to any sequence in the human genome.DepositorInsertNon-specific gRNA
UseCRISPRExpressionMammalianPromoterhU6Available SinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
PXL
Plasmid#75349PurposePX330 derived. Bbs1 & annealed oligos to insert guide strand. BstB1+Pac1 of PXL and FUX-/pRubiX- T2A-Cas9 for choice of sgRNA, viral backbone, and fluorescent protein. Pac1 to introduce 2nd sgRNA.DepositorInsertCas9
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSP977
Plasmid#65774PurposeHuman expression vector for SpCas9 D1135E variant: CMV-T7-humanSpCas9(D1135E)-NLS-3xFLAGDepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 (D1135E)-NLS-3XFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationD1135E mutation in Cas9PromoterCMV & T7Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMpGE006
Plasmid#108722PurposeCas9 expression in M.polymorphaDepositorInsertAtco-Cas9-Pea3ter
UseCRISPRExpressionPlantPromoterMpEFproAvailable SinceJune 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag3-gRNA3
Plasmid#196254PurposePlasmid for cloning the third CRISPR-Cas9 guide RNA of 4 guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag2-gRNA2
Plasmid#196252PurposePlasmid for cloning the second CRISPR-Cas9 guide RNA of multiplex guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag1-gRNA1
Plasmid#196251PurposePlasmid for cloning the first CRISPR-Cas9 guide RNA of multiplex guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag4-gRNA4
Plasmid#196255PurposePlasmid for cloning the 4th CRISPR-Cas9 guide RNA of 4 guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
M-ST1-VPR
Plasmid#68498Purposenuclease competent ST1-Cas9 fused to VPRDepositorInsertST-Cas9-VPR
TagsVPRExpressionMammalianPromoterCMVAvailable SinceSept. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
SpRY-IP
Plasmid#235994PurposeExpresses Cas9-SpRY in mammalian cellsDepositorInsertSpRY
UseCRISPRExpressionMammalianPromoterEF-1aAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTW037
Plasmid#185688PurposeT-DNA for creating transgenic plants expressing Cas9 and Drm1b gRNAsDepositorInsertCas9, Drm1b gRNA
UseCRISPRExpressionPlantAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28b-SpRY-His
Plasmid#179320PurposePlasmid for bacterial expression and purification of SpRY-Cas9DepositorInsertHuman codon-optimized Cas9 variant SpRY
UseCRISPRTags6xHis and SV40-NLSExpressionBacterialMutationSpRY=A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/ N13…Available SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28b-SpG-His
Plasmid#179318PurposePlasmid for bacterial expression and purification of SpG-Cas9DepositorInsertHuman codon-optimized Cas9 variant SpG
UseCRISPRTags6xHis and SV40-NLSExpressionBacterialMutationSpG=D1135L/S1136W/G1218K/E1219Q/ R1335Q/T1337RAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
pFC902
Plasmid#106904PurposeThe vector has a U3 promoter and terminator controlled gene encoding a transcript containing the sgRNA flanked by a tRNA-Gly repeat; and a gene encoding cas9 controlled by Ptef1 and Ttef1DepositorInsertscas9
pyrG
U3 promoter and terminator controlled gene encoding a transcript containing the sgRNA flanked by a tRNA gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV.5’-LMNA-eGFP-KI
Plasmid#170545PurposeExpresses a sgRNA for 5' tagging to LMNA and contains a cassette with eGFP flanked by homology arms for LMNADepositorInsertsLeft Homology arm for LMNA knockin
Right Homology arm for VIM knockin
UseCRISPR and LentiviralAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV.5’VIM-eGFP-KI
Plasmid#170547PurposeExpresses a sgRNA for 5' tagging to VIM and contains a cassette with eGFP flanked by homology arms for VIMDepositorInsertsLeft Homology arm for VIM knockin
Right Homology arm for VIM knockin
UseCRISPR and LentiviralAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSC51
Plasmid#104825PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma.12g075700, Glyma.11g145900 (Drb2ab). Also expresses Cas9 from rolD promoter from Gmubi promoterDepositorInsertGlyma.12g075700, Glyma.11g145900
UseCRISPRExpressionPlantAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMJ922
Plasmid#78312PurposeExpression of His6-MBP-tagged Cas9-NLS-EGFP protein in E. coliDepositorInsertSpCas9
TagsHA-2xNLS-EGFP-NLS and His6-MBP-TEVExpressionBacterialMutationhuman codon-optimized gene sequencePromoterT7Available SinceJune 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMJ923
Plasmid#78313PurposeExpression of His6-MBP-tagged Cas9-NLS-mCherry protein in E. coliDepositorInsertSpCas9
TagsHA-2xNLS-mCherry-NLS and His6-MBP-TEVExpressionBacterialMutationhuman codon-optimized gene sequencePromoterT7Available SinceJune 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDG459
Plasmid#100901PurposeSpCas9 with 2A-Puro and a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of double knock-outs and large deletions in a single plasmid system.DepositorInsertshumanized CRISPR associated protein 9
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTags3xFLAG and T2A-PuroRExpressionMammalianPromoterCBh and U6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
BPK764
Plasmid#65767PurposeBacterial expression plasmid for SpCas9 & sgRNA (need to clone spacer into BsaI sites): T7-humanSpCas9-NLS-3xFLAG-T7-BsaIcassette-Sp-sgRNADepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9-NLS-3XFlag, and SpCas9 gRNA
UseCRISPRTags3x FLAG and NLSExpressionBacterialPromoterT7 (x2)Available SinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.SFFV.GFP
Plasmid#57827PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses eGFP via P2A cleavage site. SFFV Promoter drivenDepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV
P2A-eGFP
UseCRISPR and LentiviralTagsFLAGAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSECC
Plasmid#60820Purpose3rd generation vector. Expresses a sgRNA of interest, Cas9 and CreDepositorInsertsCas9
Cre
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingTagsFlagExpressionMammalianMutationBsmBI site eliminated by C->A; E308GPromoterEFS and EFS (after Cas9-2A)Available SinceNov. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
MSP469
Plasmid#65771PurposeHuman expression vector for SpCas9 VQR variant: CMV-T7-humanSpCas9(D1135V/R1335Q/T1337R)-NLS-3xFLAG (VQR variant)DepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 (D1135V/R1335Q/T1337R)-NLS-3XFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationD1135V, R1335Q, and T1337R mutations in Cas9PromoterCMV & T7Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSP680
Plasmid#65772PurposeHuman expression vector for SpCas9 EQR variant: CMV-T7-humanSpCas9(D1135E/R1335Q/T1337R)-NLS-3xFLAG (EQR variant)DepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 (D1135E/R1335Q/T1337R)-NLS-3XFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationD1135E, R1335Q, and T1337R mutations in Cas9PromoterCMV & T7Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleAvailable SinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-OC-IRES-BSD
Plasmid#53118PurposeTo create stable cell clones with high-level expression of Cas9 and OCT1DepositorInsertsUseLentiviralTagsIRES-BSD, NLS, and P2AExpressionMammalianMutationhuman codon-optimizedPromoterCMVAvailable SinceMay 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9 probasin_mTQ2_FlpO
Plasmid#68357PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and 8, and SMAD4 ex2 and ex 9 are expressed by the U6 promoter.DepositorInserts5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9
FlpO recombinase
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianPromoterU6 and synthetic Probasin ARRx2Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTW045
Plasmid#185690PurposeT-DNA for creating transgenic plants expressing Cas9 and Drm1b gRNAsDepositorInsertCas9, Drm1b gRNAs
UseCRISPRExpressionPlantAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only