We narrowed to 16,166 results for: grna
-
Plasmid#131473PurposeEndogenous tagging of Tarpγ8: Intramolecular (amino acid position: V376)DepositorAvailable sinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-SMVP-Cas9N-U6-gRNA TdL
Plasmid#80938PurposeExpresses Cas9N in mammalian cells; expresses gRNA TdL for Ai9 cleavage.DepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable sinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYLsgRNA-OsU6c
Plasmid#66197Purposecloning of sgRNAs for expression in plantsDepositorTypeEmpty backboneUseCloning vectorPromoterOsU6cAvailable sinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pVMG0303_Cq-U6-6_2xBbsI_gRNA-Loop
Plasmid#169370PurposeExpression of gRNA in Culex quinquefasciatus or other mosquitoesDepositorInsertpVMG0303_Cq-U6-6_2xBbsI_gRNA-Loop
UseCRISPRExpressionInsectPromoterCPIJ039596Available sinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_RNF138_G1
Plasmid#127120DepositorInsertgRNA RNF138 (RNF138 Human)
UseCRISPRAvailable sinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGGDestTol2LC-3sgRNA
Plasmid#64241Purposedestination vector for three U6x:sgRNA cassettesDepositorTypeEmpty backboneUseCRISPRAvailable sinceMay 5, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGGDestTol2LC-2sgRNA
Plasmid#64240Purposedestination vector for two U6x:sgRNA cassettesDepositorTypeEmpty backboneUseCRISPRAvailable sinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330-U6-BRD4-HaloTag-Guide-hspCas9
Plasmid#228576PurposeExpression of Halo-tagged human BRD4 gRNA; CRISPR-mediated gene insertionDepositorAvailable sinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSico_U6-PLOD2 sgRNA4
Plasmid#136459PurposeExpression of gRNA against human PLOD2DepositorInsertgRNA against human PLOD2 (PLOD2 Synthetic, Human)
UseCRISPR and LentiviralExpressionMammalianAvailable sinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pLG1 library vector (pU6-sgRNA Ef1alpha-Puro-T2A-mcherry)
Plasmid#217306PurposesgRNA mcherry + PuromycinDepositorInsertpU6-sgRNA, Ef1alpha-Puro-T2A-mcherry
UseCRISPRPromoterU6, Ef1alphaAvailable sinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-SMVP-Cas9N-U6-gRNA M4
Plasmid#80937PurposeExpresses Cas9N in mammalian cells; expresses gRNA M4 for Mstn cleavage.DepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable sinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGGDestTol2LC-4sgRNA
Plasmid#64242Purposedestination vector for four U6x:sgRNA cassettesDepositorTypeEmpty backboneUseCRISPRAvailable sinceMay 5, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMOD_B2121
Plasmid#91065PurposeModule B, Promoter: GmUbi, Gene: SapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers , Terminator: 35SDepositorInsertSapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers
UseCRISPRPromoterGmUbiAvailable sinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX459-Gpr124 gRNA
Plasmid#246547PurposeCRISPR vector co-expressing Cas9 and a mouse Gpr124 gRNADepositorAvailable sinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Bla-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196074Purpose(Empty Backbone) Constitutive CRISPRi vector conferring blasticidin S resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
ExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Hyg-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196076Purpose(Empty Backbone) Constitutive CRISPRi vector conferring hygromycin B resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
ExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRP_8xgRNA-FLuc
Plasmid#135937PurposeFirefly luciferase reporter containing 8 copies of a gRNA binding site for light-inducible dCas9 activation.DepositorInsert8 copies of gRNA binding site (5'-AAAGGTCGAGAAACTGCAAA-3')
UseLuciferaseExpressionMammalianPromoterminCMVAvailable sinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only