We narrowed to 7,330 results for: Ank
-
Plasmid#227292PurposeDonor template for mStayGold insertion into the N-terminus of the CETN2 locus. For centriole visualization. To be co-transfected with sgRNA plasmid px330-CETN2 (Addgene #227291)DepositorInsertCETN2 Homology Arms flanking a mStayGold Tag (CETN2 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVX-Flag-MIB1-IRES-Puro
Plasmid#140240PurposeLentiviral vector expressing flag-tagged MIB1DepositorAvailable SinceJune 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-VIM
Plasmid#227302PurposeDonor template for mStayGold insertion into the C-terminus of the VIM locus. For intermediate filament visualization. To be co-transfected with sgRNA plasmid px330-PITCh-VIM (Addgene #227301)DepositorInsertVIM Homology Arms flanking a mStayGold Tag (VIM Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-CANX
Plasmid#227280PurposeDonor template for mStayGold insertion into the C-terminus of the CANX locus. For ER visualization. To be co-transfected with sgRNA plasmid px330-CANX (Addgene #227279)DepositorInsertCANX Homology Arms flanking a mStayGold Tag (CANX Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-mStayGold-TUBA1B
Plasmid#227321PurposeDonor template for Puro-2A-mStayGold insertion into the N-terminus of the TUBA1B locus. For tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B (Addgene #207763)DepositorInsertTUBA1B Homology Arms flanking a Puro-2A-mStayGold Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus niā¦Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-miRFP670nano3-Blast-H3C2
Plasmid#207784PurposeDonor template for miRFP670nano3-2A-Blast insertion into the C-terminus of the H3C2 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 Addgene #207780DepositorInsertH3C2 Homology Arms flanking a miRFP670nano3-Blast Cassette (H3C2 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
TVBB C-term-mScarlet
Plasmid#169219PurposeTargeting vector backbone to support a knock-in of Linker-mScarlet at the C-terminus of a target locusDepositorInsertDouble SapI flanked mScarlet
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR-AmCyan
Plasmid#138481PurposeFor cloning sgRNA flanked by two ribozyme elements, to subsequently cloned into PL-5LTR-GW-A vector.DepositorInsertAmCyan
ExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-MAPRE1
Plasmid#227324PurposeDonor template for mStayGold insertion into the C-terminus of the MAPRE1 locus. For growing microtubule tip visualization. To be co-transfected with sgRNA plasmid px330-PITCh-MAPRE1 (Addgene #207793)DepositorInsertMAPRE1 Homology Arms flanking a mStayGold Tag (MAPRE1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
TVBB N-term-mTurquoise2
Plasmid#169222PurposeTargeting vector backbone to support a knock-in of mTurquoise2-Linker at the N-terminus of a target locusDepositorInsertDouble SapI flanked mTurquoise2
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
FLAG-LoxP-GFP-LoxP-SNAP-TERT
Plasmid#71391PurposeHomologues recombination donor plasmid for inserting a FLAG-SNAP-tag at the N-terminus of the TERT locus in human cells. Includes GFP marker flanked by LoxP sites for selection.DepositorAvailable SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pInt-ERCreER
Plasmid#190040PurposeThis is an integration donor plasmid to insert a DNA fragment for doxycycline inducible ERT2-Cre-ERT2 at the AAVS1 locus. It works with an AAVS1 targeting CRISPR/Cas9 construct (Addgene #72833).DepositorInsertERT2-Cre-ERT2 flanked by AAVS1
UseCRISPR and TALENExpressionMammalianAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMT-sox10-cytoBirA-2A-mCherry_Ras
Plasmid#80062PurposeSox10 promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterSox10 promoterAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
LV-indLS2
Plasmid#123068PurposeLentiviral construct that delivers a tamoxifen inducible Cre. Upon recombination, luc2 and mStrawberry express. Used to image spontaneous tumorigenesis or subclonal cell populations in vivo.DepositorInsertsCreERT2 with intron
Firefly luciferase
mStrawberry
UseLentiviral and Luciferase; FluorescenceExpressionMammalianMutationsynthetic intron added as indicatedPromoterCAGGS (after Cre mediated inversion) and CAGGS (fā¦Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-EMTB-TurboID-V5
Plasmid#190736PurposeMammalian expression of EMTB fusion to V5-tagged TurboID on microtubules (EMTB as the microtubule-targeting tag)DepositorInsertensconsin (MAP7 Human)
TagsMyc, TurboID, and V5ExpressionMammalianMutationMicrotubule binding-domain of ensconsin (amino acā¦PromoterCMVAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
TVBB C-term-mNeongreen
Plasmid#169227PurposeTargeting vector backbone to support a knock-in of Linker-mNeongreen at the C-terminus of a target locusDepositorInsertDouble SapI flanked mNeongreen
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-moxGFP-TUBA1B
Plasmid#207767PurposeDonor template for Puro-2A-moxGFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Puro-moxGFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
PL-5LTR-GW-A
Plasmid#138480PurposeFor expression of ribozyme-flanked sgRNA after the Gateway (GW) LR cloning.DepositorInsertGateway attR1/R2 cassette with chloramphenicol resistance and ccdB genes
ExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBetaActin-FKBP-mScarlet-Dync1h1motor
Plasmid#191330PurposeExpresses the fluorescently labeled dynein motor domain fused to dimerization domain FKBP to recruit it to the plasma membrane by using the chemical dimerization system FKBP-FRBDepositorInsertFKBP-mScarlet-Dync1h1motor (Dync1h1 Mouse)
ExpressionMammalianMutationDYNC1H1 motor domain aa 1453-4644Available SinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
TVBB N-term-mScarlet
Plasmid#169218PurposeTargeting vector backbone to support a knock-in of mScarlet-Linker at the N-terminus of a target locusDepositorInsertDouble SapI flanked mScarlet
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pME-lox-3xSTOP-lox (JDW 869)
Plasmid#224521PurposeA Gateway compatible middle entry clone containing a loxP flanked SV40 polyA, bGH polyA, and SV40 pA stop cassetteDepositorInsertLoxP-3xStop-LoxP
UseCre/LoxAvailable SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR-DMD-Donor
Plasmid#60605PurposeKnock-in donor vector to insert Exon 44 in front of Exon 45 of human DYSTROPHIN (DMD)gene, include EF1a-hygromycin resistance cassette flanked by loxP sequences.DepositorInsertHygromycin resistant gene
UseKnock-in donor vectorExpressionMammalianAvailable SinceDec. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMB953:PB-CAG-PuroR-nGFP-FLEx-mCherry-KASH-WPRE
Plasmid#168106PurposePiggyBac transposon vector constitutively driving PuroR-P2A-eGFP and Cre conditional expression of KASH nuclear membrane-bound mCherry. Conditional insert flanked by MCS for cloningDepositorInsertmCherry-KASH
UseCRISPR and Cre/LoxPromoterCAGAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
TVBB C-term-mTurquoise2
Plasmid#169223PurposeTargeting vector backbone to support a knock-in of Linker-mTurquoise2 at the C-terminus of a target locusDepositorInsertDouble SapI flanked mTurquoise2
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTub-alpha1-EB3-NeonGreen-T2A-iLifeact-mCherry
Plasmid#175261Purposelabelling of microtubule plus end and F-actin structuresDepositorInsertEB3-NeonGreen-T2A-iLifeact-mCherry (MAPRE3 Human)
TagsmCherry (on iLifeact) and mNeonGreen (on EB3)ExpressionMammalianMutationNone (wt)PromoterpTub-alpha1Available SinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-sTagRFP-TUBA1B
Plasmid#207769PurposeDonor template for Puro-2A-sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Puro-sTagRFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Aquamarine-LC3B-TdLanYFP
Plasmid#228560PurposeEncodes the LC3B biosensor where LC3B is flanked by the Aquamarine/TdLanYFP donor/accpetor FRET pair and under the control of the CMV promoterDepositorAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCol1a1-frt (FVB)
Plasmid#63575PurposeTargeting vector for the Col1a1 locus that contains a Neo resistance cassette flanked by FRT sites, followed by an ATG-less Hygromycine resistance gene. The homology arms match the sequence of FVB.DepositorInsertCol1A-frt-hygro-pA
UseMouse Targeting; Frt/flpeExpressionBacterial and MammalianPromoterNoneAvailable SinceMarch 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCRII-Topo Vglut2 in situ probe
Plasmid#45639DepositorInsertVglut2 in situ probe (Slc17a6 Mouse)
UseIn situMutationfragment contains nt 2477-2993 of slc17a6 (Vglut2ā¦Available SinceJune 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
attB53-Pac-TRE-3xFlag-Neurog1-attB53
Plasmid#183613PurposeRMCE vector to shuttle puromycin resistance and TRE-3xFlag-Neurog1 cassettes into attP50-flanked landing pad. Designed for use with pmROSA26-attP50-Neo-mKate2-3xNLS-attP50 vector (Addgene 183609).DepositorAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCINeo-mCHMP5
Plasmid#11771DepositorInsertchromatin modifying protein 5 (Chmp5 Mouse)
ExpressionMammalianAvailable SinceMay 12, 2006AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1/mCherry-DMDEx23
Plasmid#211367PurposeExpresses a DMD exon 23 skipping reporter in mammalian cells (mCherry-DMDEx23)DepositorInsertmCherry-DMDEx23
TagseGFPExpressionMammalianMutationmCherry interrupted by mdx dystrophin exon 23 betā¦PromoterCMVAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSET-XS-VWF
Plasmid#64847PurposeExpresses aa1594ā1670 of VWF A2 domain flanked by Venus and Cerulean and tagged with 7X His at C terminusDepositorInsertVenus_VWF A2 domain aa 1594-1670_Cerulean_TEV_7X His (VWF Synthetic, Human)
Tags7X His, Cerulean, and VenusExpressionBacterialPromoterT7Available SinceMay 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
kanMX6-ins6
Plasmid#195043PurposepFA6a derived selection cassette 5' flanked with tDEG1 transcription terminator, allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertKanR
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF prā¦Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENT-L1-Kozak-GAP43-ECFP-stop-L2
Plasmid#186356PurposeEntry clone with ORF encoding plasma membrane-targeted GAP43-eCFP flanked by Gateway recombination sequencesDepositorInsertGrowth-associated protein-43 (Gap43 Mouse, Synthetic)
UseExpression of a fluorescent membrane markerTagsECFPAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMTB2-cytoBirA-2A-mCherry_Ras
Plasmid#80066PurposeBeta-actin2 promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterBeta-actin2Available SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pENT-L1-Kozak-Ensconsin-3XGFP-stop-L2
Plasmid#186361PurposeEntry clone with ORF encoding the MT-binding domain of Ensconsin fused to 3 copies of GFP in C-terminal, flanked by Gateway recombination sequences.DepositorInsertHuman Ensconsin (MAP7 Synthetic, Human)
UseExpression of a fluorescent microtubule markerTags3xEGFPAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMTB2-NLS-BirA-2A-mCherry_Ras
Plasmid#80067PurposeBeta-actin2 promoter driving HA-tagged biotin ligase (BirA) with NLS, a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterBeta-actin2Available SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBactin-Nedd1-mNeonGreen
Plasmid#196864PurposeExpression of neural precursor cell expressed developmentally down-regulated 1 (Need1) fused to mNeonGreenDepositorInsertNedd1-mNeonGreen (Nedd1 Rat)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
natMX-ins7
Plasmid#195044PurposepFA6a derived selection cassette 5' flanked with tCYC1 transcription terminator, allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertNatR
UseYeast genomic targetingTagstCYC1 S. cerevisiae, pPGK1 C. glabrata, NatR, tPGā¦Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-H3C2
Plasmid#207783PurposeDonor template for moxGFP-2A-Puro insertion into the C-terminus of the H3C2 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 Addgene #207780DepositorInsertH3C2 Homology Arms flanking a moxGFP-Puro Cassette (H3C2 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMT-myl7-cytoBirA-2A-mCherry_Ras
Plasmid#80060PurposeMyl7 promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterMyl7 promoterAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-sTagRFP-TUBA1B
Plasmid#207768PurposeDonor template for Blast-2A-sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Blast-sTagRFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMT-zic2a-cytoBirA-2A-mCherry_Ras
Plasmid#80064PurposeZic2a promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterZic2a enhancer driving c-fos promoterAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMT-ubb-NLS-BirA-2a-mCherry
Plasmid#79886PurposeUbiquitin promoter driving HA-tagged biotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein; flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
Tags3x HAExpressionBacterialPromoterUbiquitinAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMT-MCS-NLS-BirA-2A-mCherry_Ras
Plasmid#80059PurposeMCS for cloning promoter to drive HA-tagged biotin ligase (BirA) with NLS, a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1 ObLiGaRe Donor vector/EPB58
Plasmid#90016PurposeDonor vector for ObLiGaRe/ZFN mediated targeting to AAVS1 locusDepositorInsertMCS flanked by inverted ZFN binding sites (PPP1R12C Human)
ExpressionBacterialAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ZKSCAN1_Tau7-12WT
Plasmid#194166PurposeInsert contains intronic ZKSCAN1 Alu repeat elements flanked by the wild-type tau cDNA exons 7,9-12. Expresses the tau circRNA 12-->7 WT with 3X flag tag in exon 7.DepositorInsertMicrotubule-associated protein tau 7-12 WT
Tags3X FlagExpressionMammalianAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ZKSCAN1_Tau10-12WT
Plasmid#194163PurposeInsert contains intronic ZKSCAN1 Alu repeat elements flanked by the wild-type tau cDNA exons 10-12. Expresses the tau circRNA 12-->10 WT with 3X flag tag in exon 10.DepositorInsertMicrotubule-associated protein tau 10-12 WT ZKSCAN1 intronic alu elements
Tags3X flag tagExpressionMammalianAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only