We narrowed to 18,361 results for: JUN
-
Plasmid#164487PurposeExpression of TVADepositorAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only
-
TRPML3-HA
Plasmid#18832DepositorAvailable SinceJuly 14, 2008AvailabilityAcademic Institutions and Nonprofits only -
p221z-dCAS9p-t35s
Plasmid#118387PurposeEntry clone containing dCAS9p and 35S terminator. Used to make CRISPR construct . For use in plants and compatible with the MultiSite Gateway systemDepositorInsertdCAS9p
UseCRISPRAvailable SinceSept. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJH643
Plasmid#172168PurposeReporter plasmid for pylBCD variant in pBAD backboneDepositorInsertPara sfGFP.3TAG; Plpp pylS; PproK pylT; AraC; Cam
ExpressionBacterialMutationsfGFP(N39*, N135*, Y151*)Available SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAC1812_pCR8-gCasRx-CUG (control gRNA)
Plasmid#118645PurposeTransient transfection; Expressed Control (CUG repeat) CasRx gRNA; Gateway DonorDepositorInsertgCasRx-CUG
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKSCTMF
Plasmid#85073PurposeGene insertion/deletion in Pichia pastorisDepositorInsertAOX1promoter - mazF - AOX1 tt- Zeocin R gene
UseGene insertion/deletion in pichia pastorisPromoterpAOX1Available SinceMarch 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-Dendra2-Nat
Plasmid#236494PurposePlasmid for deleting or C-terminally tagging endogenous genes with Dendra2 and selection on Nat.DepositorInsertDendra2
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
Gata4-GFP donor
Plasmid#113115PurposeDonor plasmid for knock-in eGFP fusing to the c-terminal of mouse Gata4 coding sequenceDepositorInsertGata4 donor region including homology arms and eGFP
UseSynthetic BiologyAvailable SinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHPyV6-607a
Plasmid#24727DepositorInsertFull genome of Human polyomavirus 6
UseViral cloneAvailable SinceJune 8, 2010AvailabilityAcademic Institutions and Nonprofits only -
BiP-mGFP P495L
Plasmid#62232PurposeMutant of hamster BiP-mGFP unable to bind clients.DepositorInserthamster BiP-mGFP-KDEL
TagsmGFPExpressionMammalianPromotercmvAvailable SinceMarch 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAd5-B6-deltaE3
Plasmid#122559PurposeModified block 6, with deletion in E3DepositorInsertAdenovirus 5 genomic region 27859-30803
UseSynthetic BiologyMutationAdenovirus sequences 27859-30803 replaced with Ba…Available SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSCW02
Plasmid#72301PurposeStarting substrate for in vitro DNA mismatch repair substrate monitored by FauI cleavage. Derived from pUC19CPDrev H. HWang and J.B. Hays 2002 JBC 277:26136.DepositorTypeEmpty backboneUseDerivative of puc19ExpressionBacterialPromoterlacAvailable SinceAug. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorInsertGGTGTAACGTGGAGCCAGTA
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDL1
Plasmid#182263PurposeGibson cloning vector for synthesis of single and double stranded RNADepositorTypeEmpty backboneUseGibson cloning vector for synthesis of single and…PromoterT3 and SP6 for sense and antisense riboprobe synt…Available SinceJune 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330A-1x5
Plasmid#58769PurposeExpresses Cas9 nuclease and gRNADepositorInserthumanized S. pyogenes Cas9 nuclease
UseCRISPRTags3xFLAGExpressionMammalianPromoterCBhAvailable SinceNov. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
PBS Actb-2A-TIR1-GFP
Plasmid#113832Purposetargeting osTIR1-GFP into mouse Actb locus for auxin inducible degradationDepositorInsertosTIR1-GFP (NEWENTRY Synthetic)
UseSynthetic BiologyAvailable SinceAug. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO_NES_STf
Plasmid#182001PurposeCMV overexpression of SNAP-tag fast strictly in the cytoplasm of mammalian cell linesDepositorInsertNES-STf
ExpressionMammalianMutationFast mutation on SNAP-tag E30RPromoterCMVAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGCDNsam-Foxa2
Plasmid#33004DepositorInsertforkhead box A2 (Foxa2 Mouse)
UseRetroviralAvailable SinceFeb. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pZE31ms2
Plasmid#25860DepositorInsertms2 binding site (x2)
ExpressionBacterialMutationnoneAvailable SinceNov. 2, 2010AvailabilityAcademic Institutions and Nonprofits only -
CAG.mCherry-eDHFR
Plasmid#176201PurposeNegative control of targeted optogenetic manipulation using TMP-Halo dimerization systemDepositorInsertmCherry-eDHFR
ExpressionMammalianAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only