We narrowed to 7,330 results for: Ank
-
Plasmid#160577Purpose35S promoter sequence and the Mtb terminator flanked by two opposing PhiC31 site-specific recombination sites (attP and attB)DepositorInsertPhiC31 PB (attP:TMtb:P35S:attB)
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
TVBB C-term-Dendra2
Plasmid#169216PurposeTargeting vector backbone to support a knock-in of Linker-Dendra2 at the C-terminus of a target locusDepositorInsertDouble SapI flanked Dendra2-P2A-Puro
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
C-His-GvpC-Calpain
Plasmid#153295PurposeExpresses calpain-sensitive variant of Anabaena flos-aquae GvpC in E.coliDepositorInsertCalpain-sensitive Gas vesicle protein C (his-tagged)
TagsHis-tagExpressionBacterialMutation1) Contains an extra glycine after the methionine…PromoterT7Available SinceSept. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
STK32B gRNA (BRDN0001146403)
Plasmid#76373Purpose3rd generation lentiviral gRNA plasmid targeting human STK32BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK32B gRNA (BRDN0001145394)
Plasmid#76374Purpose3rd generation lentiviral gRNA plasmid targeting human STK32BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK32B gRNA (BRDN0001144884)
Plasmid#76375Purpose3rd generation lentiviral gRNA plasmid targeting human STK32BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_FOidr_131
Plasmid#244683PurposeExpress mEGFP-tagged intrinsically disordered protein (IDR), FOidr_131, derived from human fusion protein PAX5_BZW1; PAX5_CBFA2T3; PAX5_ESRRA; PAX5_FOXP1; PAX5_JAK2; PAX5_KANK1; PAX5_NCOA5; PAX5_NOL4L; PAX5_PAX5; PAX5_ZCCHC7; PAX5_ZNF276; PAX5_ZNF521; ZCCHC7_PAX5DepositorInsertFOidr_131
Tagsmonomeric EGFPExpressionMammalianMutationUnmutatedAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-TetOn-DEST-EFS-mODC-rtTA-IRES-NEO (JDW 931)
Plasmid#242578PurposePiggyBac transposon flanked, Tet-on, gateway destination vector.DepositorInsertattR1-CmR-ccdB-attR2
ExpressionMammalianAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBI121::chitGFP5:AQ
Plasmid#240450PurposeExpression of indicator protein fusion (soluble modified GFP5 & Aequorin) for monitoring calcium concentrations in cell walls of higher plants. See Resource Information.DepositorInsertFusion of Chitinase signal, smGFP5, and Aequorin
ExpressionBacterial and PlantMutationGFP5 for expression plants (PMID 9122158); Solubl…PromoterCauliflower mosaic virus 35S promoter (GenBank AJ…Available SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVM-SFT-SP
Plasmid#234902PurposeThis all-in-one vector is used to overexpress the GhSFT gene via virus-mediated overexpression (VOX), and specifically silence the GhSP gene via virus-induced gene silencing (VIGS), simultaneously.DepositorInsertAdditional VA component flanked with VIGS fragment of GhSP gene and coding sequence of GhSFT
ExpressionPlantAvailable SinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-AtmiR173aTS-B/c
Plasmid#227965PurposeExpression plasmid with a ccdB cassette flanked with two inverted BsaI restriction sites. For expressing syn-tasiRNAs in Arabidopsis thaliana.DepositorInsertsB/c
AtmiR173aTS
ExpressionPlantPromoter35S and NoneAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC131_CCR5(SFFV-synEPOR-2A-YFP)
Plasmid#232412PurposeAAV production plasmid for SFFV(synEPOR) vector from Figs. 2-3 that mediates HDR at CCR5 locus using CCR5 gRNA. YFP is followed by BGH polyA. AAV genome is flanked by AAV2 ITRs.DepositorAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC175_HBA1reg(synEPOR)
Plasmid#232413PurposeAAV production plasmid for HBA1 UTRs vector from Fig. 3 that mediates HDR at HBA1 locus using HBA1 sg5 gRNA. HBB gene includes introns; HBA1 UTRs flank H+C15BA1 cassette. HAs are ~400bp each.DepositorAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC177_CCR5(PGK-synEPOR)
Plasmid#232415PurposeAAV production plasmid for PGK(synEPOR) vector from Figs. 3-5 that mediates HDR at CCR5 locus using CCR5 gRNA. synEPOR is followed by BGH polyA. AAV genome is flanked by AAV2 ITRs.DepositorAvailable SinceMarch 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
Aquamarine-LC3B G120A-TdLanYFP
Plasmid#228561PurposeEncodes an uncleavable version of the LC3B biosensor. Mutated LC3B is flanked by the Aquamarine/TdLanYFP donor/accpetor FRET pair and under the control of the CMV promoterDepositorAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mScarlet-MAPRE1
Plasmid#227323PurposeDonor template for mScarlet insertion into the C-terminus of the MAPRE1 locus. For growing microtubule tip visualization. To be co-transfected with sgRNA plasmid px330-PITCh-MAPRE1 (Addgene #207793)DepositorInsertMAPRE1 Homology Arms flanking a mScarlet Tag (MAPRE1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-EZR
Plasmid#227294PurposeDonor template for mStayGold insertion into the C-terminus of the EZR locus. For membrane visualization. To be co-transfected with sgRNA plasmid px330-EZR (Addgene #227293)DepositorInsertEZR Homology Arms flanking a mStayGold Tag (EZR Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-H3C2
Plasmid#227334PurposeDonor template for mStayGold insertion into the C-terminus of the H3C2 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 (Addgene #207780)DepositorInsertH3C2 Homology Arms flanking a mStayGold Tag (H3C2 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-miRFP670nano3-H3C2
Plasmid#227335PurposeDonor template for miRFP670nano3 insertion into the C-terminus of the H3C2 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 (Addgene #207780)DepositorInsertH3C2 Homology Arms flanking a miRFP670nano3 Tag (H3C2 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-MAP4
Plasmid#227296PurposeDonor template for mStayGold insertion into the N-terminus of the MAP4 locus. For microtubule visualization. To be co-transfected with sgRNAplasmid px330-PITCh-MAP4 (Addgene #227295)DepositorInsertMAP4 Homology Arms flanking a mStayGold Tag (MAP4 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-CEP192
Plasmid#227289PurposeDonor template for mStayGold insertion into the C-terminus of the CEP192 locus. For pericentriolar material visualization. To be co-transfected with sgRNA plasmid px330-PITCh-CEP192 (Addgene #227288)DepositorInsertCEP192 Homology Arms flanking a mStayGold Tag (CEP192 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME-rox-nls-mCherry-V5-2xStop-rox (JDW 1167)
Plasmid#224524PurposeA Gateway compatible middle entry clone containing a Rox flanked 3xNLS-mCherry-V5-2xStop cassetteDepositorInsertrox-3xNLS-mCherry-V5-2xSTOP-rox
UseGateway cloningAvailable SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME iCre-I (JDW 1203)
Plasmid#224520PurposeA Gateway compatible middle entry clone containing a loxP flanked, self inactivating Cre that contains an intron to prevent recombination in bacteriaDepositorInsertiCre-I
UseCre/LoxAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-V5-LMNB1
Plasmid#207779PurposeDonor template for Blast-2A-V5 insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-V5 Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-C-Solo-mScarlet-H3C2
Plasmid#207781PurposeDonor template for mScarlet insertion into the C-terminus of the H3C2 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 Addgene #207780DepositorInsertH3C2 Homology Arms flanking a mScarlet Tag (H3C2 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-C-mNeon-Blast-H3C2
Plasmid#207782PurposeDonor template for mNeon-2A-Blast insertion into the C-terminus of the H3C2 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 Addgene #207780DepositorInsertH3C2 Homology Arms flanking a mNeon-Blast Cassette (H3C2 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-moxGFP-TUBA1B
Plasmid#207766PurposeDonor template for Blast-2A-moxGFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Blast-moxGFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC19-π-EB1_IRES-mCherry
Plasmid#197427PurposeHomology-directed repair template targeting IRES-based π-element to MAPRE1 exon 5DepositorInsertIRES-based π-element with HDR templates flanking MAPRE1 exon 5 insertion site (MAPRE1 Human)
UseCRISPR and Synthetic BiologyTagsGCN4 leucine zipper, LOV2, Zdk1, and mCherryAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19-π-EB1_EF1α-mCherry
Plasmid#197429PurposeHomology-directed repair template targeting EF1α-based π-element to MAPRE1 exon 5DepositorInsertEF1α-based π-element with HDR templates flanking MAPRE1 exon 5 insertion site (MAPRE1 Human)
UseCRISPR and Synthetic BiologyTagsGCN4 leucine zipper, LOV2, Zdk1, and mCherryAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19-π-EB1_EF1α-EGFP
Plasmid#197430PurposeHomology-directed repair template targeting EF1α-based π-element to MAPRE1 exon 5DepositorInsertEF1α-based π-element with HDR templates flanking MAPRE1 exon 5 insertion site (MAPRE1 Human)
UseCRISPR and Synthetic BiologyTagsEGFP, GCN4 leucine zipper, LOV2, and Zdk1Available SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-Nedd1-mOrange2
Plasmid#196860PurposeExpression of neural precursor cell expressed developmentally down-regulated 1 (Nedd1) fused to mOrange2DepositorInsertNedd1-mOrange2 (Nedd1 Rat)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-rox-inv[Talpha1-iCre-pA]-rox-LynGFP
Plasmid#196874PurposeNeuron-specific expression of LynGFP reporter. Used in combination with Talpha1-Dre-pA plasmidsDepositorInsertLynGFP
UseCre/Lox; Dre/roxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-Dre-pA]-lox-Lyn-EGFP
Plasmid#196876PurposeNeuron-specific expression of LynGFP reporter. Used in combination with Talpha1-iCre-pA plasmidsDepositorInsertLynEGFP
UseCre/Lox; Dre/roxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-DIO-inv[roxSTOProx-ZsGreen-bGH]
Plasmid#196883PurposeDual Cre/Dre-dependent expression of ZsGreen. Used as Cre-Dre cotransfection reporterDepositorInsertroxSTOProx-ZsGreen-bGH
UseCre/Lox; Dre/roxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-DIO-inv[roxSTOProx-Lyn-GFP-bGH]
Plasmid#196884PurposeDual Cre/Dre-dependent expression of LynGFP. Used as Cre-Dre cotransfection reporterDepositorInsertroxSTOProx-Lyn-GFP-bGH
UseCre/Lox; Dre/roxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-DIO-inv[roxSTOProx-ZsGreen-bGH]
Plasmid#196886PurposeDual Cre/Dre-dependent expression of ZsGreen. Used as Cre-Dre cotransfection reporterDepositorInsertroxSTOProx-ZsGreen-bGH
UseCre/Lox; Dre/roxExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBetaActin-FKBP-Halo-Dync1h1motor
Plasmid#191333PurposeExpresses the fluorescently labeled dynein motor domain fused to the dimerization domain FKBP to recruit it to the plasma membrane by using the chemical dimerization system FKBP-FRBDepositorInsertFKBP-Halo-Dync1h1motor (Dync1h1 Mouse)
ExpressionMammalianMutationDYNC1H1 motor domain aa 1453-4644Available SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBetaActin-FKBP-Dync1h1motor
Plasmid#191332PurposeExpresses the dynein motor domain fused to the dimerization domain FKBP to recruit it to the plasma membrane by using the chemical dimerization system FKBP-FRBDepositorInsertFKBP-Dync1h1motor (Dync1h1 Mouse)
ExpressionMammalianMutationDYNC1H1 motor domain aa 1453-4644Available SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_Tau Authentic Alu 10-12WT
Plasmid#194167PurposeInsert contains intronic Tau authentic Alu and repeat elements. The introns are flanked by the Wild Type tau cDNA exons 10-12 . Expresses the tau circular RNA 12-->10 WT with 3X flag tag in exon 10.DepositorInsertMicrotubule-associated protein tau 10-12 WT
Tags3X FlagExpressionMammalianAvailable SinceJan. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_Tau Authentic Alu 7-12WT
Plasmid#194170PurposeInsert contains intronic Tau authentic Alu and repeat elements. The introns are flanked by the Wild Type tau cDNA exons 7,9-12 . Expresses the tau circular RNA 12-->7 WT with 3X flag tag in exon 7.DepositorInsertmicrotubule-associated protein tau 7-12 WT
Tags3x FlagExpressionMammalianAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ZKSCAN1_Tau10-12V337M
Plasmid#194165PurposeInsert contains intronic ZKSCAN1 Alu repeat elements flanked by tau cDNA exons 10-12 with FTLD-Tau V337M mutation. Expresses the tau circRNA 12-->10 V337M with 3X flag tag in exon 10.DepositorInsertMicrotubule-associated protein tau 10-12 V337M
ExpressionMammalianMutationChanged Valine 337 to MethinonineAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pS97splitRBP_S2-Enz
Plasmid#183768PurposeExpresses SHIP2-Enzyme domain flanked by RBPDepositorInsertSHIP2 (INPPL1 Human)
Tags6HIS, RBP (C-terminal) HRV3C cleavage site, and R…ExpressionBacterialMutationincludes aa K414 to aa V872 onlyPromoterT7lacAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Prom1 Del EC2
Plasmid#184025PurposeMammalian Flag tagged expression clone for the mouse Prom1 splicing variant SV8 (GenBank accession BC028286). Deletion of exon 19a (amino acids 696-701), and deletion of amino acids 273-287.DepositorInsertProm1 SV8(-Ex19a) Del EC2 (Prom1 Mouse)
TagsFlagExpressionMammalianMutationDeletion of exon 19a (amino acids 696-701), and d…Available SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 PhiC31 RL (attR:P35S:TMtb:attL) (GB1506)
Plasmid#160582Purpose35S promoter inverted sequence and the Mtb terminator flanked by two opposing PhiC31 site-specific recombination sites (attR and attL)DepositorInsertattR:P35S:TMtb:attL
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV_COL4A3_self-cleavingCas9
Plasmid#130281PurposeExpresses an spCas9 under the control of a CMV promoter; The spCas9 is flanked by COL4A3 sgRNA targets to induce its self-cleaving and inactivationDepositorInsertspCas9
UseAAVPromoterCMVAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV_COL4A5_self-cleavingCas9
Plasmid#130282PurposeExpresses an spCas9 under the control of a CMV promoter; The spCas9 is flanked by COL4A5 sgRNA targets to induce its self-cleaving and inactivationDepositorInsertspCas9
UseAAVPromoterCMVAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
vPyACR_2164382
Plasmid#153029PurposeAnion-conducting channelrhodopsin of viral origin. Codon-optimized for mammalian expression (human/mouse).DepositorInsertvPyACR_2164382
TagseYFPExpressionMammalianMutationvPyACR_2164382 was C-terminally truncated to incl…PromoterCMV (+ enhancer)Available SinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
vPyACR_21821
Plasmid#153030PurposeAnion-conducting channelrhodopsin of viral origin. Codon-optimized for mammalian expression (human/mouse).DepositorInsertvPyACR_21821
TagseYFPExpressionMammalianMutationvPyACR_21821 was C-terminally truncated to includ…PromoterCMV (+ enhancer)Available SinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSB139 - pL0_ZCT1 (CDS1)
Plasmid#123184PurposeGolden Gate (MoClo; CDS1) compatible ZCT1 gene from Catharanthus roseus; a repressor of the STR1 promoter from C. roseusDepositorInsertZCT1 from Catharanthus roseus
UsePart for plant expressionExpressionPlantMutationNo BpiI and BsaI sitesAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only