169,450 results
-
Plasmid#169915PurposeExpression of sgRNA on an optimized gRNA scaffold contains A-U pair flip stabilize the CjCas9/sgRNA complex.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only
-
polyQ74-GFP
Plasmid#231893PurposeForms cytosolic HTT partial exon 1 Q74 aggregatesDepositorInsertHTT partial exon 1 Q74 (HTT Human)
TagsEGFPExpressionMammalianMutationCAG repeat expansionAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
PGK-IKZF3-CTERM-GFP
Plasmid#185779PurposeDegron-GFP fusion plasmid with restriction sites BamH1 and EcoR1 around GFP for subcloningDepositorInsertGFP
UseLentiviralTagsV5, IKZF3 minidegronMutationnonePromoterPGKAvailable SinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBK1304-AAV-EFSNC-dCjCas9-KRAB-MECP2
Plasmid#223149PurposeExpression of KRAB and truncated MECP2 with dCjCas9 and empty gRNA scaffoldDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-TetOn-ZIM3-KRAB-dCas9-P2A-mCherry
Plasmid#212829PurposeDoxycycline-inducible (Zim3)KRAB-dCas9-HA-P2A-mCherry cassette for integration at the AAVS1-locus of the human genome.DepositorInsertZIM3-KRAB-dCas9-P2A-mCherry
TagsHA-tag and ZIM3-KRABExpressionBacterial and MammalianPromoterCAG, TetOnAvailable SinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti- V6.3 Ultra-Chili
Plasmid#106173Purposelentiviral CMV driven tdTomato-P2A-T2A, Blasticidin selectableDepositorInsertdTomato
UseLentiviralTagsT2A, P2AExpressionMammalianPromoterCMVAvailable SinceJuly 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 TAP DHX36
Plasmid#53547Purposemammalian expression of DHX36DepositorAvailable SinceJune 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCT-tRNA
Plasmid#133813PurposeCRISPR-Cas9 system for genetic manipulation of Candida tropicalisDepositorInsertcassette for the expression of the sgRNA from the Ashbya gossypii RNA pol II TEF1 promoter
UseCRISPRAvailable SinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-3xGFP-tDeg
Plasmid#191371PurposeOverexpression of 3xGFP-tDeg in human cellsDepositorInsert3xGFP-tDeg
Tags3xGFPExpressionMammalianAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Mm.cargo(Cre)
Plasmid#174862PurposeExpresses mouse Peg10 cargoRNA encoding Cre recombinaseDepositorInsertCre flanked by MmPeg10 UTRs
ExpressionMammalianPromoterCMVAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CD74-ROS1 nonmutant
Plasmid#183813PurposeExpress CD74-ROS1 fusion (C6;R34) in mammalian cellsDepositorUseLentiviralTagsThe fusion protein of CD74 exon 1-6 and ROS1 exon…ExpressionMammalianPromoterCMVAvailable SinceApril 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT/TO SF-HERC2 (ShB-R)
Plasmid#55613PurposeDox-inducible expression of full length, ShB-resistant, 3xFLAG/STREP tagged wild-type HERC2 in Flp-In TREx cellsDepositorInsert3xFLAG tagged HERC2 (WT) (HERC2 Human)
Tags3xFLAG and STREPExpressionMammalianMutationSilent mutations have been incorporated into the …Available SinceJuly 23, 2014AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Rab7A Q67L
Plasmid#28049DepositorAvailable SinceMay 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-dCas9-mCherry-ZIM3-KRAB
Plasmid#154473PurposeExpresses dCas9 fused to mCherry and the KRAB domain of ZIM3DepositorInsertZIM3 (ZIM3 Human)
UseLentiviralTagsHAExpressionMammalianMutationIncludes ZIM3 aa 1-100PromoterSFFVAvailable SinceOct. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCSFLPe
Plasmid#31130DepositorInsertFLP recombinase
ExpressionMammalianAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.LSL.tdTomato
Plasmid#100048PurposeAAV mediated Cre-dependent expression of tdtomato (Lox-Stop-Lox)DepositorInserttdtomato
UseAAV and Cre/LoxExpressionMammalianPromoterCAGAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-Flag-humanRBM47
Plasmid#134607PurposePlasmid bearing RBM47 coding sequence. Flag tagged is useful for IP and WB assays.DepositorArticleAvailable SinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPSU20-40-60-80
Plasmid#173839PurposeCoexpresses 20, 40, 60 and 80 kD Penn State ladder proteinsDepositorInsertSTRHSTPABPACCBPv3
ExpressionBacterialPromoterT7Available SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
TRPML1-EGFP
Plasmid#245039PurposeExpresses TRPML1 with C-terminus EGFP tag in mammalian cellsDepositorAvailable SinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(cyto).iGlucoSnFR2
Plasmid#244091PurposeCytosolic expression of green glucose sensorDepositorInsertiGlucoSnFR2
UseAAVAvailable SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Syn.NES-jRGECO1a.WPRE.SV40 (AAV Retrograde)
Viral Prep#100854-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV.Syn.NES-jRGECO1a.WPRE.SV40 (#100854). In addition to the viral particles, you will also receive purified pAAV.Syn.NES-jRGECO1a.WPRE.SV40 plasmid DNA. Synapsin-driven GECO1a calcium sensor. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJune 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPAP004
Plasmid#160911PurposeE.coli/ P.pastoris shuttle plasmid for episomal expression in P.pastorisDepositorInsertlacZ selection cassette
ExpressionYeastAvailable SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1a-Luciferase-IRES-Blast-WPRE
Plasmid#108542PurposeLentivirus vector expressing Luciferase with blasticidin resistanceDepositorInsertsLuciferase
Neomycin
UseLentiviralPromoterEF1apha and PGKAvailable SinceApril 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple GaoA
Plasmid#196051PurposeEncodes a G alpha subunit (GNAO1 Isoform Alpha 1) with RLuc8, a G gamma subunit (GNG8) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensorDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-R-iLACCO1
Plasmid#208025PurposeBiosensor for intracellular L-lactateDepositorInsertR-iLACCO1
ExpressionMammalianAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3-sRGN3.1-BlastR
Plasmid#220964PurposeExpresses human codon-optimized sRGN3.1DepositorInsertsRGN3.1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNP3440 [pNP2922 - ISCro4 bRNA (TBL2, WT + DBL1, WT) + ISCro4 Recombinase (WT)]
Plasmid#247263PurposeExpress ISCro4 recombinase and bridge RNADepositorInsertpNP2922 - ISCro4 bRNA1-179 (WT, TBL2 + DBL1)
ExpressionMammalianAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-28a-hPKM2
Plasmid#44242DepositorAvailable SinceApril 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PIK3CA-H1047R
Plasmid#116500PurposeLentiviral expression of PIK3CA H1047RDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only