We narrowed to 161,851 results for: TRI
-
Plasmid#91600PurposeExpress sgRNA targeting human DLGAP1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pPN190
Plasmid#91577PurposeExpress sgRNA targeting human BRINP2DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
HINT2-bio-His
Plasmid#53406PurposeExpresses full-length Histidine triad nucleotide-binding protein 2 precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertHINT2 (HINT2 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV5b HA Irx5 deltaHD
Plasmid#24997DepositorAvailable SinceAug. 2, 2010AvailabilityAcademic Institutions and Nonprofits only -
pTET GFP10-FRB/FKBP-GFP11
Plasmid#182497PurposeTripartite split-GFP. E. coli vector. Inducible coexpression of GFP10-FRB and FKBP-GFP11 coiled coilsDepositorInsertsTagssplit GFP10 tripartite and split GFP11 tripartiteExpressionBacterialPromoterTETAvailable SinceApril 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPtGE34
Plasmid#107932PurposeExpresses Cas9 in Phaeodactylum tricornutum / Encodes elements required for conjugationDepositorInsertsOriT
40SRPS8 Promoter
ShBle
40SRPS8 Terminator
Cen6-ArsH4-His3
UseCRISPR and Synthetic Biology; Episomal vector for…Available SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
lenti-SpCas9 hygro
Plasmid#104995PurposeThis lentiviral construct delivers hSpCas9 and hygromycin resistance.DepositorInsertKpnI-XhoI-BsrGI-NheI
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
lenti-SpCas9 puro
Plasmid#104994PurposeThis 3rd generation lentiviral construct delivers hSpCas9 and puromycin resistance.DepositorInsertKpnI-XhoI-BsrGI-NheI
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
lenti-SpCas9 blast
Plasmid#104997PurposeThis lentiviral construct delivers hSpCas9 and blasticidin S resistance.DepositorInsertKpnI-XhoI-BsrGI-NheI
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pF CAG luc IRES neo
Plasmid#98294PurposeFor constitutive expression of firefly luciferase from the CAG promoter together with an IRES-linked neo resistance geneDepositorInsertsFirefly luciferase
IRES
Neomycin resistance gene (NeoR)
UseLentiviral and LuciferaseAvailable SinceJuly 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pF CAG BFP2 IRES neo
Plasmid#108175PurposeExpresses a blue fluorescent protein (BFP2) in mammalian cells along with conferring resistance to G418DepositorInsertBlue fluorescent protein (BFP2)
UseLentiviral; Fluorescent proteinExpressionMammalianPromoterCAGAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
AiP12421 - pAAV-AiE0444h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2421)
Plasmid#191713PurposeAI plasmid ALIAS: AiP12421. Expression of SYFP2 (yellow fluorescent protein) in striatal indirect pathway medium spiny neurons (D2-MSNs), enrichment in dorsal striatum over ventral striatumDepositorInsertSYFP2
UseAAVMutationnoneAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP12965 - pAAV-AiE0444h-minBG-mTFP1-WPRE3-BGHpA (Alias: CN2965)
Plasmid#191729PurposeAI plasmid ALIAS: AiP12965. Expression of mTFP1 (monomeric teal fluorescent protein) in striatal indirect pathway medium spiny neurons (D2-MSNs), enrichment in dorsal striatum over ventral striatumDepositorInsertmTFP1
UseAAVMutationnoneAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE7
Plasmid#214812PurposeMammalian expression of SpCas9 PE7 prime editorDepositorInsertPE7
TagsSV40 bpNLS and c-Myc NLSExpressionMammalianPromoterCMVAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Fon-oScarlet
Plasmid#137136PurposeIntersectional viral expression of oScarlet in cells expressing both Cre AND FlpDepositorHas ServiceAAV8InsertCon/Fon-oScarlet
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationE95DPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-2xFYVE
Plasmid#140050PurposeExpresses mCherry-tagged HRS 2xFYVE in mammalian cellsDepositorInserttandem HRS FYVE domain (Hgs Mouse)
TagsmCherryExpressionMammalianMutationtwo FYVE domains (amino acids 147-223), linked by…PromoterCMVAvailable SinceMay 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-mTagBFP2
Plasmid#99374PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A mTagBFP2 from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-mTagBFP2
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1a and hU6Available SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-eGFP
Plasmid#99375PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A eGFP from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-eGFP
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1a and hU6Available SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pScalps_Puro_mTet2 catalytic domain
Plasmid#79554PurposeExpression of catalytic domain of mouse Tet2DepositorAvailable SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
mCherry-Sec61b-C1
Plasmid#90994PurposeExpresses mCherry-tagged Sec61b, brightly labels endoplasmic reticulum in mammalian cellsDepositorInsertmCherry-Sec61b (SEC61B Human, Synthetic)
TagsmCherry (red fluorescence)ExpressionMammalianPromoterCMVAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-dTomato
Plasmid#99376PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A dTomato from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-dTomato
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1a and hU6Available SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-Con/Fon-GCaMP6M
Plasmid#137119PurposeIntersectional viral expression of GCaMP6M in cells expressing both Cre AND FlpDepositorHas ServiceAAV8InsertCon/Fon-GCaMP6M
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationRemoved RSET tagPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRK5-myc Metap2
Plasmid#199685PurposeTransient expression of Metap2DepositorAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMT-sox10-NLS-BirA-2A-mCherry_Ras
Plasmid#80063PurposeSox10 promoter driving HA-tagged biotin ligase (BirA) with NLS, a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterSox10 promoterAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEF6-CSPG4-myc-his
Plasmid#69037PurposeExpression of CSPG4 in mammalian cellsDepositorAvailable SinceSept. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Foff 2.0-mCherry
Plasmid#137133PurposeIntersectional viral expression of mCherry in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-mCherry
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationn/aPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
mEmerald-Sec61b-C1
Plasmid#90992PurposeExpresses mEmerald-tagged Sec61b, brightly labels endoplasmic reticulum in mammalian cellsDepositorInsertmEmerald-Sec61b (SEC61B Human, Synthetic)
TagsmEmerald (green fluorescence)ExpressionMammalianPromoterCMVAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET-PE2-His (IK1822)
Plasmid#170103PurposeT7 promoter bacterial expression plasmid for PE2 (nSpCas9(H840A)-MMLV-RT) with C-terminal 6xHis-tag and bipartite NLSDepositorInsertbpNLS-nSpCas9(H840A)-MMLVRT-bpNLS-6xHis
UseCRISPRTags6xHis tagExpressionBacterialMutationBacteria codon-optimized nSpCas9 (H840A) & M-…PromoterT7Available SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-PinkyCaMP
Plasmid#232860PurposeAn AAV vector expressing the mScarlet based calcium indicator PinkyCaMP under CAG promoterDepositorInsertPinkyCaMP
UseAAVExpressionMammalianPromoterCAGAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
NanoLuc-PM
Plasmid#164784PurposeNanoluciferase (NanoLuc) targeted to the extracellular surface of the cell membrane for bioluminescence resonance energy transfer (BRET)-based measurement of ligand binding to unmodified receptorsDepositorInsertNanoluciferase fused with the transmembrane domain of the platelet-derived growth factor receptor beta (PDGFRB Oplophorus gracilirostris, Human)
TagsNanoLucExpressionMammalianPromoterCMVAvailable SinceMay 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pALS2-sfGFP 150TAG
Plasmid#197574PurposeFluorescence selection plasmid for selecting ncAA-encoding Methanomethylophilus alvus Pyl-RS mutants. Expresses sfGFP-150TAG and M. alvus Pyl-tRNA(6). p15a origin of replication.DepositorInsertssfGFP 150TAG
M. alvus Pyl-tRNA (6)
TagsHis6ExpressionBacterialMutationN150TAGPromoteraraC and lppAvailable SinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-hM4D(Gi)-mCherry-WPREpA
Plasmid#154867PurposeFlp-dependent hM4D(Gi) DREADD-mCherryDepositorHas ServiceAAV Retrograde and AAV8InserthM4D(Gi)-mCherry
UseAAV; Flp-frtTagsmCherryExpressionMammalianPromoterHuman Synapsin-1Available SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a-gp32-H6
Plasmid#163912PurposeExpresses T4 gp32 for bacterial expression and affinity purificationDepositorInsertgp32
TagsHisExpressionBacterialPromoterT7 promoterAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-GFP-Puro_TAL1-long
Plasmid#210642PurposeOverexpression of TAL1-longDepositorAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-GFP-Puro_TAL1-short
Plasmid#210641PurposeOverexpression of TAL1-shortDepositorAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Fon-mCherry
Plasmid#137132PurposeIntersectional viral expression of mCherry in cells expressing both Cre AND FlpDepositorHas ServiceAAV8InsertCon/Fon-mCherry
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationn/aPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
JWW-2 human chimeric monoclonal antibody
Plasmid#66749PurposeExpresses a murine/human chimeric IgG1 HPV16 L2-specific neutralizing antibody that recognizes HPV16 L2 amino acid region 58-64 . JWW-2 works in ELISA/WB/HPVDepositorInsertsJWW-2 Heavy Chain
JWW-2 Light Chain
ExpressionMammalianPromotermEF1 and rEF1Available SinceAug. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
Anti-6xHis [N144/14R]
Plasmid#177500PurposeMammalian Expression Plasmid of anti-6xHis. Derived from hybridoma N144/14.DepositorInsertanti-6xHis recombinant mouse monoclonal antibody
ExpressionMammalianPromoterDual CMVAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a-uvsX-H6
Plasmid#163913PurposeExpresses uvsX for bacterial expression and affinity purificationDepositorInsertuvsX
TagsHisExpressionBacterialPromoterT7 promoterAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.iAChSnFR
Plasmid#137955PurposeExpresses iAChSnFR under CAG promoterDepositorArticleHas ServiceAAV1InsertiAChSnFR
UseAAVExpressionMammalianPromoterCAGAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
GIV-WT - FLAG
Plasmid#65947PurposeExpression GIV/Girdin in Mammalian cellDepositorAvailable SinceOct. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
Tau (wt) -VC
Plasmid#87369Purposeexpresses hTau fused to the C-terminal part of VenusDepositorAvailable SinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMT-Hrp48-ADARcd-V5
Plasmid#81172Purposeidentification of cell-specific targets of RNA binding proteinsDepositorInsertHrp48-ADARcd fusion (Hrb27C Fly)
ExpressionInsectPromoterDrosophila metallothionein promoterAvailable SinceAug. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1α-BHLHE40-IRES-ZsGreen1
Plasmid#153061PurposeLentiviral vector expressing human BHLHE40DepositorAvailable SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hPDGFRA-GFP
Plasmid#22919DepositorInserthuman platelet derived growth factor receptor alpha polypeptide promoter driving GFP (PDGFRA Human)
UseAAVExpressionMammalianAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONRp5-p2 SspB-mCherry-CShroom3
Plasmid#170977PurposeC-terminal component of OptoShroom3 optogenetic tool. Translocates to apical junctions to induce constriction upon blue light illumination if coexpressed with GFP-NShroom3-iLID. pDONRp5-p2 plasmid.DepositorInsertCShroom3 (Shroom3 Mouse)
UseGateway CloningTagsSspB and mCherryMutationIsoform X2, deleted aminoacids 1 - 1388Available SinceJuly 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQC V5 mKO2 HuR.DelHNS IRES Puro
Plasmid#110389Purposeγ-Retroviral transfer vector for expressing HuR (delHNS), V5 and mKO2 tags, IRES-driven Puromycin selection.DepositorInsertELAV like RNA binding protein 1 (ELAVL1 Human)
UseRetroviralTagsV5 and mKO2ExpressionMammalianMutationHNS (HuR nuclear-cytoplasmic shuttling sequence) …PromoterCMVAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Coff/Fon-mCherry
Plasmid#137134PurposeIntersectional viral expression of mCherry in cells expressing Flp AND NOT CreDepositorHas ServiceAAV8InsertCoff/Fon-mCherry
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationn/aPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLJM1 flag-cFLIP
Plasmid#211529PurposeExpresses flag-tagged cFLIP (CFLAR)DepositorAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only