We narrowed to 19,259 results for: Tec;
-
Plasmid#74854PurposeGateway cloning compatible binary vector for N-terminal fusion with FLAG (CaMV35S promoter).DepositorTypeEmpty backboneExpressionPlantPromoterCaMV35SAvailable SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only
-
MCP-M-MLV RT∆RNase H
Plasmid#213749PurposeFor circular RNA-mediated prime editor using MCP-M-MLV RT∆RNase H in HEK293T cellsDepositorInsertMCP-M-MLV RT∆RNase H
UseCRISPRTagsBPNLSExpressionMammalianPromoterCMVAvailable SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGWB517
Plasmid#74859PurposeGateway cloning compatible binary vector for C-terminal fusion with 4xMyc (CaMV35S promoter).DepositorTypeEmpty backboneExpressionPlantPromoterCaMV35SAvailable SinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEdit
Plasmid#232355PurposeThe pEdit series plasmids are derived from the pTarget series plasmids by inserting homologous recombination arms targeting the gene of interest, which enables gene knockout or gene insertion at the tDepositorInsertsgRNA
UseCRISPRAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
LRG (Lenti_sgRNA_EFS_GFP)
Plasmid#65656PurposeLentiviral introduction of sgRNA constitute expression linked with GFP marker into mammalian cell line.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 promoter-driven sgRNA expression and EFS promo…Available SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLentiRNACRISPR_012-TetO-NLS-inactive-hfCas13d-NLS-WPRE-EFS-rtTA3-2A-Blast
Plasmid#228558PurposeExpresses inactive hfCas13d in mammalian cells for binding of target RNAs in combination with compatible crRNAs. Localized to the nucleusDepositorInsertdhfCas13d (N2V8)
UseLentiviralTagsNLS-HAMutationR239A/H244A/R858A/H863AAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGWB414
Plasmid#74808PurposeGateway cloning compatible binary vector for C-terminal fusion with 3xHA (CaMV35S promoter).DepositorTypeEmpty backboneExpressionPlantPromoterCaMV35SAvailable SinceOct. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-APOBEC1-YTH
Plasmid#131636PurposeExpresses APOBEC1 fused to the YTH domainDepositorAvailable SinceOct. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAF0689 Ef1a-Pa01_attB-BFP acceptor
Plasmid#193472PurposeAcceptor plasmid for 3 plasmid recombination assayDepositorInsertPa01_attB
ExpressionMammalianPromoterEf1aAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVDL9.3
Plasmid#168299PurposeSecretion of polypeptides (nanobodies) in E. coli fused to C-terminal secretion signal of HlyADepositorInsertSegment of the hly operon, spanning the C-terminal part of hlyA, hlyB, and hlyD
ExpressionBacterialPromoterLacI-PlacAvailable SinceJune 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
FLAG NC
Plasmid#214675PurposeNegative control plasmid for splicing reporters consisting of MCP fused FLAG epitope tagsDepositorInsertFLAG
TagsMCP and V5ExpressionMammalianPromoterEF-1aAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
3XFlagNICD1
Plasmid#20183DepositorInsertNotch 1 Intracellular Domain (Notch1 Mouse)
Tags3XFLAGExpressionMammalianMutationContains murine Notch 1 Intracellular Domain (Val…PromoterCMVAvailable SinceDec. 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCB578
Plasmid#141095PurposeE. coli-Lactobacilli shuttle vector containing SpCas9, tracrRNA, and a repeat-spacer-repeat arrayDepositorInsertsCas9 and tracrRNA
repeat-spacer-repeat array
ExpressionBacterialAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
LbCas12a-niCPE
Plasmid#213747PurposeFor circular RNA-mediated prime editor using LbCas12a-niCPE in HEK293T cellsDepositorInsertMCP-nLbCas12a-M-MLV RT∆RNase H
UseCRISPRTagsBPNLSExpressionMammalianMutationD156R, R1138A in LbCas12aPromoterCMVAvailable SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAnc80L65AAP
Plasmid#92307PurposeAdeno-associated Viral Vector (AAV) capsid Anc80L65 in AAV2Rep expression construct with endogenous AAPDepositorInsertAncestral AAV Capsid Anc80L65AAP
UseAAV and Synthetic BiologyExpressionMammalianPromoterRep2Available SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pR26 CAG/GFP Asc
Plasmid#74285PurposeGene targeting vector for the mouse Rosa26 locus, including a CAG promoter, loxP flanked stop cassette and GFP, for cloning into AscIDepositorInsertRosa26 5-homology region
UseMouse TargetingAvailable SinceApril 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX551
Plasmid#60957PurposepAAV-pMecp2-SpCas9-spA (AAV-SpCas9). AAV plasmid expressing Cas9 in neurons under control of truncated mecp2 promoter.DepositorInsertSpCas9
UseAAV and CRISPRTagsHAExpressionMammalianPromoterpMecp2Available SinceNov. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
3xHA-TurboID_pAS31
Plasmid#118220Purposeexpresses 3xHA-tagged TurboID in C. elegans intestineDepositorInsertTurboID (BirA mutant)
Tags3x HA tagExpressionWormMutationQ65P, I87V, R118S, E140K, Q141R, S150G, L151P, V1…Promoterges-1pAvailable SinceJan. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_eCB2.0
Plasmid#164604PurposeExpress the endocannabinoid sensor GRAB_eCB2.0 in neuronsDepositorInsertEndocannabinoid sensor GRAB_eCB2.0
UseAAVMutationS383TPromoterhSynAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
mCherry-Clathrin LC-15
Plasmid#55019PurposeLocalization: Clathrin Vesicles, Excitation: 587, Emission: 610DepositorAvailable SinceAug. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRDB_161
Plasmid#216091PurposeCas9 [Sp] CRISPRi targeting CD81, positive controlDepositorInsertCD81 guide
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-Cas9-6xHis
Plasmid#62374PurposeExpression of Cas9-6xHis in bacterial cellsDepositorInsertCas9_6xHis
Tags6xHis tagExpressionBacterialPromoterT7Available SinceMay 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCI-globin_del5UTR_WT-xrRNA-4H
Plasmid#108366PurposeExpresses wild type beta-globin reporter; enables detection of 5'-3' decay intermediates (xrFrag) and allows detection via northern blot (4H binding sites)DepositorInsertWild type beta-globin reporter with MVE xrRNA and 4H probe binding sites
ExpressionMammalianPromoterCMVAvailable SinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCI-globin_del5UTR_PTC39-xrRNA-4H
Plasmid#108367PurposeExpresses beta-globin reporter with premature termination codon (PTC39); enables detection of 5'-3' decay intermediates (xrFrag) and allows detection via northern blot (4H binding sites)DepositorInsertPTC39 beta-globin reporter with MVE xrRNA and 4H probe binding sites
ExpressionMammalianMutationPTC39PromoterCMVAvailable SinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
U6-5'+3' MS2-CircRNA
Plasmid#213752PurposeFor circular RNA-mediated prime editor using U6-5'+3' MS2-CircRNA in HEK293T cellsDepositorInsert5' ribozyme, 5' ligation sequences, 5' MS2, 3' MS2, 3' ligation sequences, 3' ribozyme
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
Factor IX donor
Plasmid#182141PurposeFactor IX donor for twinPE and Bxb1 mediated insertion at ALBDepositorInsertattP-Factor IX intron 1 and exon 2-8 CDS and exon 8 3'UTR
ExpressionMammalianAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-15b-TEV-C9R
Plasmid#118754PurposeTEV-C9R protease expression vector with enhanced expression, solubility and yield without affecting TEV's protease activityDepositorInsertTobacco Etch Virus protease (NEWENTRY Synthetic)
TagsC9R and His tagExpressionBacterialPromoterT7Available SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
U6-5' MS2-CircRNA
Plasmid#213750PurposeFor circular RNA-mediated prime editor using U6-5' MS2-CircRNA in HEK293T cellsDepositorInsert5' ribozyme, 5' ligation sequences, 5' MS2, 3' ligation sequences, 3' ribozyme
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNA motif plasmid cloning backbone
Plasmid#107253PurposeRNA motif plasmid with BoxB sites. Digest with BsmBI and insert RNA motif of interest. Stuffer size 1.8kbDepositorInsertRNA motif plasmid cloning backbone
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2018AvailabilityAcademic Institutions and Nonprofits only