We narrowed to 15,149 results for: egf
-
Plasmid#220808PurposeExpress separately the Rotavirus SA11 NSP3 protein and the original enhanced GFP (Yang et al., 1996)DepositorInsertRotavirus SA11 NSP3-F2A-EGFP
UseOtherAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
3xFlag-eGFP-Flag-SETX
Plasmid#218838PurposeMammalian expression of GFP-tagged SETX construct for subcellular localization studies with GFP, or immunoprecipitation with Flag tag.DepositorAvailable SinceJune 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRES2-eGFP-Ofd1-Myc
Plasmid#24560DepositorAvailable SinceMay 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
pUC19 - T7 pro - IRES - EGFP
Plasmid#138586PurposeExpress EGFP with an upstream T7 promoter in pUC19 backboneDepositorInsertEGFP
Available SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide Puro-P2A-EGFP
Plasmid#137729PurposeFor simple determination of the multiplicity of infection (MOI) of a lentiviral CRISPR library by checking EGFP expression (still allowing for puro selection).DepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyTagsEGFPExpressionBacterial and MammalianAvailable SinceFeb. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP-LAMP1-EGFP-APEX2-V5
Plasmid#236402PurposeExpresses a fluorescent lysosome-localized APEX2DepositorInsertLAMP1-EGFP-APEX2-V5
UseRetroviralTagsAPEX2, EGFP, and V5ExpressionMammalianAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFH2.10_Gag-MCP-P2A-eGFP
Plasmid#205525PurposeExpress HIV Gag-MCP-P2A-eGFPDepositorInsertGag-MCP
ExpressionMammalianMutationWTPromoterCMVAvailable SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA1_D262V-FLAG-IRES-eGFP
Plasmid#234620PurposeMammalian expression of full-length hnRNPA1 D262V with C-terminal FLAG tag co-expressing with eGFP via IRES sequenceDepositorInserthnRNPA1 D262V (HNRNPA1 Human)
TagsFLAGExpressionMammalianMutationFamillial ALS mutation D262V, C-terminal FLAG tag…PromoterCMVAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP-EGFP-APEX2-V5-EEA1
Plasmid#236403PurposeExpresses a fluorescent endosome-localized APEX2DepositorInsertEGFP-APEX2-V5-EEA1
UseRetroviralTagsAPEX2, EGFP, and V5ExpressionMammalianAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXR001: EF1a-CasRx-2A-EGFP
Plasmid#109049PurposeCasRx (NLS-RfxCas13d-NLS) with 2A-EGFP for RNA targetingDepositorInsertCasRx
UseCRISPR and LentiviralTags2A-eGFP, HA, and NLSExpressionMammalianPromoterEF1AAvailable SinceMay 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
Str-Golgin84_VSVG-SBP-EGFP
Plasmid#65305Purposesynchronize trafficking of Golgin-84 from the Golgi apparatus (RUSH system)DepositorInsertGolgin-84 (GOLGA5 Human)
TagsEGFP and Streptavidin Binding Protein (SBP)ExpressionMammalianPromoterCMVAvailable SinceAug. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET23b-2E2-HA-mEGFP-6xHis
Plasmid#129594PurposeThe encoded protein is the anti-HA frankenbody variant fused with the mEGFP and His-tag. This plasmid is for bacteria protein expression under T7 promoter and protein purification with HisTrap.DepositorInsertAnti-HA frankenbody variant-mEGFP (2E2-HA scFv-mEGFP)
Tags6xHis-tagExpressionBacterialPromoterT7Available SinceOct. 28, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLKO.1-puro_CMV_NES-Caprola_06-mEGFP
Plasmid#194693PurposeCMV driven expression of the calcium recorder Caprola_06 fused to mEGFP for neuronal expression through through lentivirus transductionDepositorInsertCaprola_06-mEGFP
UseLentiviralTagsmEGFPPromoterCMVAvailable SinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PuroR-T2A-eGFP
Plasmid#234734PurposePuromycin resistance/eGFP cassette in mammalian cells (transfection marker)DepositorInsertPuroR-T2A-eGFP
ExpressionMammalianAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAF0084 Ef1a-Cp36-2a-EGFP
Plasmid#193462PurposeExpression of Cp36 recombinase from Ef1a promoterDepositorInsertCp36
ExpressionMammalianPromoterEf1aAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N2-2XNLS-RNaseH1 delta 1-27 (WT)
Plasmid#196702PurposePlasmid for transient mammalian expression of wild type RNase H1 tagged with 2xNLS and EGFP that can be used to specifically degrade the nuclear R-loops.DepositorInserthuman RNaseH1 wild type
ExpressionMammalianAvailable SinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EGFP-P4M-SidMx2
Plasmid#136997PurposeLentiviral EGFP lipid sensor for PI(4)PDepositorInsertEGFP-P4M-SidMx2
UseLentiviralTagsEGFPPromoterEF1 alphaAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAVone-AAV2-CMV-eGFP
Plasmid#230930PurposepAAVone plasmid is used to package AAV-CMV-eGFP with an AAV2 serotype, utilizing the AAVone single-plasmid AAV production system.DepositorInserteGFP
UseAAVPromoterCMVAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-Cep123 (CCDC123/Cep89)
Plasmid#67787PurposeThis plasmid encodes EGFP fused to the N-terminus of isoform 1 of Cep123 (CCDC123/Cep89)DepositorAvailable SinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only