We narrowed to 4,859 results for: U6...
-
Plasmid#129041Purposeinactivated control (targeted DNA demethylation_human_TSDR), expression of dCas9-hudTET1CD-T2A-mCherry sgRNA1 targeting human TSDRDepositorInsertdCas9-hudTET1CD, SgRNA1 (huTSDR)
UseTagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available sinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-mCherry(PX458)-SghuTSDR-8
Plasmid#129036Purposetargeted DNA demethylation_human_TSDR, expression of dCas9-huTET1CD-T2A-mCherry and sgRNA8 targeting human TSDRDepositorInsertdCas9-huTET1CD, SgRNA8 (huTSDR)
UseTagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available sinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.AU1.C_NGFR
Plasmid#158314PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.AU1.CExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.C.VSVg_NGFR
Plasmid#158315PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.C.VSVgExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Tag.C.S.Ollas_NGFR
Plasmid#158303PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsTag.C.S.OllasExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.Ollas.C_NGFR
Plasmid#158268PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHSV.Ollas.CExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTBL681 CHYRON4 integration construct
Plasmid#126449PurposeTo integrate the CHYRON4 locus at AAVS1 in human cells.DepositorInsertspU6/3xLacO-CHYRON4 hgRNA
pCMV-puro
UseTagsExpressionMammalianMutationThe SpCas9 sgRNA constant region is mutated to ma…PromoterCMV and human U6/3xLacOAvailable sinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.AU1.V5_NGFR
Plasmid#158235PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.AU1.V5ExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.C.V5_NGFR
Plasmid#158310PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.C.V5ExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.C.FLAG_NGFR
Plasmid#158311PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.C.FLAGExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.C.NWS_NGFR
Plasmid#158312PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.C.NWSExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.C.HA_NGFR
Plasmid#158313PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.C.HAExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEN_hU6miR-G12-E
Plasmid#25757PurposeEntry vector with human U6 promoter driving mouse G alpha 12 miR30-based shRNA.DepositorInsertG alpha 12 miR-shRNA (Gna12 Mouse)
UseEntry vectorTagsExpressionMutationPromoterAvailable sinceJuly 14, 2010AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.VSVg.C_NGFR
Plasmid#158263PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.VSVg.CExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_FLAG.VSVg.C_NGFR
Plasmid#158260PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsFLAG.VSVg.CExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTE3334
Plasmid#107537PurposeExpresses Mb crRNA and human codon optimized MbCpf1(RVR mutant) in mammalian cells.DepositorInsertsMb crRNA
hMbCpf1(RVR mutant)
UseTags3xHA and NLSExpressionMammalianMutationN576R, K582V, N586RPromoterCMV and human U6Available sinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-mCherry(PX458)-SgmouseTSDR-1
Plasmid#129053Purposetargeted DNA demethylation_mouse_TSDR, expression of dCas9-huTET1CD-T2A-mCherry and sgRNA1 targeting mouse TSDRDepositorInsertdCas9-huTET1CD, SgRNA1 (mouseTSDR)
UseTagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available sinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-mCherry(PX458)-SghuTSDR-1
Plasmid#129029Purposetargeted DNA demethylation_human_TSDR, expression of dCas9-huTET1CD-T2A-mCherry and sgRNA1 targeting human TSDRDepositorInsertdCas9-huTET1CD, SgRNA1 (huTSDR)
UseTagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available sinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTE3330
Plasmid#107534PurposeExpresses Lb crRNA and human codon optimized LbCpf1(RVR mutant) in mammalian cells.DepositorInsertsLb crRNA
hLbCpf1(RVR mutant)
UseTags3xHA and NLSExpressionMammalianMutationG532R, K538V, Y542RPromoterCMV and human U6Available sinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only