We narrowed to 76,197 results for: lat
-
Plasmid#46753PurposeRetroviral vector that expresses wild type HA-tagged human USP7DepositorAvailable SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only
-
GST PTBP1 isoform 4
Plasmid#108594PurposeRecombinant GST tagged protein productionDepositorInsertPTBP1 isoform 4 (PTBP1 Human)
TagsGSTExpressionBacterialMutationisoform 4 (isoform a)PromotertacAvailable SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
Cav3-YFP
Plasmid#69507PurposeExpression of fluorescently tagged Caveolin-3 in mammalian cellsDepositorAvailable SinceSept. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pG2J
Plasmid#102882PurposeExpresses OsTIR1 via the ADH1 promoter, and the mGFP-AID via the TEF1 promoter in yeast. Both cassettes are integrated in HO locus. Assembly and characterization of the auxin-inducible degradation.DepositorInsertsOsTIR1
mGFP-AID
TagsAID(71-114)ExpressionYeastPromoterADH1 and TEF1Available SinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBABE-Flag-Cdk9-D167N-IRES-eGFP
Plasmid#28098DepositorInsertCdk9 (CDK9 Human)
UseRetroviralTagsFLAGExpressionMammalianMutationContains D167N mutation in Cdk9Available SinceApril 12, 2011AvailabilityAcademic Institutions and Nonprofits only -
pET30-ARH3-His-Sumo-HA
Plasmid#111578PurposeExpresses ARH3 (amino acids 14-363) in E. coliDepositorInsertARH3 (ADPRS Human)
Tags6xHis-Sumo and HAExpressionBacterialMutationdeleted amino acids 1-13PromoterT7Available SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCK341
Plasmid#192640PurposeExpresses dSpRY and MCP-SoxS(R93A/S101A) on p15A-CmRDepositorInsertsSp.pCas9-dSpRY
BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPR and Synthetic BiologyMutationSoxS has R93A and S101A mutations and dSpRY has s…PromoterBBa_J23107 and Sp.pCas9Available SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-CLASP2 512-650
Plasmid#24409DepositorInsertCLASP2 (512-650) (CLASP2 Human)
TagsEGFPExpressionMammalianMutationCLASP2 deletion mutant with only MT plus end trac…Available SinceApril 23, 2010AvailabilityAcademic Institutions and Nonprofits only -
pBABE-Flag-Cdk9-T186A-IRES-eGFP
Plasmid#28097DepositorInsertCdk9 (CDK9 Human)
UseRetroviralTagsFLAGExpressionMammalianMutationContains T186A mutation in Cdk9Available SinceApril 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
FKBP-epsin(144-575)-GFP
Plasmid#100733PurposeTo express a clathrin "hook" in mammalian cells to hot-wire endocytosisDepositorInsertepn1 (Epn1 Mouse)
TagsFKBP and GFPExpressionMammalianMutationclathrin binding middle part aa 144-575PromoterCMVAvailable SinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG-CMV14/p14ARF
Plasmid#78760PurposeTo overexpress p14ARF in Mammalian CellsDepositorAvailable SinceJune 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pQHA-USP7 CS puroR
Plasmid#46754PurposeRetroviral vector that expresses catalytically inactive form of HA-tagged human USP7DepositorInsertUSP7 (USP7 Human)
UseRetroviralTagsHAExpressionMammalianMutationC223S--catalytically inactivePromoterCMVAvailable SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
PTPRJ-bio-His
Plasmid#51816PurposeExpresses full-length Receptor-type tyrosine-protein phosphatase eta precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertPTPRJ (PTPRJ Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
SERPINH1
Plasmid#155999PurposeFor use in RBP tethering screenDepositorAvailable SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYFP-ErbB2
Plasmid#66948PurposeMammalian expression of rat ErbB2 tagged with YFPDepositorInsertErbB2 (Erbb2 Rat)
Tags6xHis, V5 Tag, and YFPExpressionMammalianMutation(See depositor comment below on mutations A24T an…PromoterCMVAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC116
Plasmid#62344PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFPDepositorInsertssgRNA + 2x MS2 (wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGCPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
PRPF19
Plasmid#155847PurposeFor use in RBP tethering screenDepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
PPIB
Plasmid#155838PurposeFor use in RBP tethering screenDepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-3myc-6His-EZH2 21A
Plasmid#42663DepositorAvailable SinceJuly 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSKC12 - DelQ
Plasmid#110493PurposeMonitor the expression of Luciferase driven by a mutated NRAS 5'-UTR.DepositorInsertNRAS 5'- DelQ (bp 30-254) (NRAS Human)
UseLuciferaseTagsFirefly luciferaseMutationDeletion of the first 29 base pairs of the NRAS 5…PromoterT7Available SinceJuly 20, 2018AvailabilityAcademic Institutions and Nonprofits only