169,450 results
-
Plasmid#229679PurposeHomology repair plasmid for endogenous tagging of AP1muA at the C-terminus with monomeric StayGold. Contains a hygromycin resistance cassette for selection of edited cellsDepositorAvailable SinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pYPQ202
Plasmid#86198PurposeMultisite Gateway T-DNA entry plasmid (attR1 & attR2); AtUBQ10 promoter and Hygromycin resistance markerDepositorTypeEmpty backboneUseGateway compatible attr1-attr2 destination vectorExpressionPlantPromoterArabidopsis ubiquitin 10 (AtUbi10)Available SinceMay 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28a-PHGDH
Plasmid#74113PurposeExpression of N-terminal His-taggedDepositorAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMS_366
Plasmid#182131Purposeexpresses retron RNA, ec.86 Reverse Transcriptase, and CspRecT SSAP, to create a specific rifampicin resistance mutationDepositorInsertsretron RNA
ec.86 RT
CspRecT
Mutationincorporated rifampicin-resistance-conferring don…Available SinceSept. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-AAVS1-Ef1a-Blast
Plasmid#227267PurposeEmpty AAVS1 targeting donor for the insertion of Blast and a strong EF1a promoter. A CDS can be cloned adjacent to the promoter via restriction or gibson cloning using the MluI cut site.DepositorTypeEmpty backboneUseCRISPR; Donor cassetteExpressionMammalianAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
DD-Cas9 with filler sequence and Cre-ERT2 (EDCICE)
Plasmid#90086PurposeThis plasmid contains destabilized Cas9 and has Cre-ERT2 after IRES sequence. This vector also contains filler sequence which required to be removed for cloning of desired sgRNADepositorInsertCas9
UseCRISPR and LentiviralTagsDestabilized Domain and FlagExpressionMammalianPromoterEFSAvailable SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
TFORF1282
Plasmid#143483PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
scAAV-Cre
Plasmid#177933PurposeExpresses Cre-recombinase and can be packaged into AAV particles.DepositorInsertCAG-Cre
UseAAVExpressionMammalianPromoterU6Available SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
Flag-ATXN1
Plasmid#48189PurposeExpresses Ataxin1DepositorAvailable SinceOct. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hIBA1a-GFP-miR124T (AAV5)
Viral Prep#214147-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-hIBA1a-GFP-miR124T (#214147). In addition to the viral particles, you will also receive purified pAAV-hIBA1a-GFP-miR124T plasmid DNA. hIBA1a-driven and miR124T-targeted for microglial inhibition of GFP. These AAV preparations are suitable purity for injection into animals.DepositorTagsGFPAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-P(Per2)-DIO-intron2-dLUC
Plasmid#110059PurposePer2 transcription luciferase reporterDepositorInsertPer2 promoter and luciferase (Per2 Mouse)
UseAAV and Cre/LoxExpressionMammalianPromoterPer2Available SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiPVe3_GCaMP6f (AAV PHP.eB)
Viral Prep#213943-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV_BiPVe3_GCaMP6f (#213943). In addition to the viral particles, you will also receive purified pAAV_BiPVe3_GCaMP6f plasmid DNA. Expression of GCaMP6f under the control of the PV+ basket cell-targeting enhancer E3. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMF440
Plasmid#62550PurposeBroad host range plasmid for constitutive expression of mCherry. Designed for expression in Pseudomonas aeruginosa.DepositorInsertmCherry
ExpressionBacterialPromotertrcAvailable SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
CapChR2_pmScarlet-N1
Plasmid#188032PurposeExpresses CapChR2-mScarlet in mammalian cellsDepositorInsertCapChR2-mScarlet
TagsmScarletExpressionMammalianMutationS43D, L112C, T139C and N238E mutations in CoChRPromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-gRNA(anti-sense) hUbC-VP64-dCas9-VP64-T2A-GFP
Plasmid#66707Purposeexpresses a single gRNA and VP64-dCas9-VP64DepositorInsertshU6-gRNA expression cassette
S.Pyogenes VP64-dCas9-VP64
UseLentiviral and Synthetic BiologyTagsVP64MutationD10A and H840APromoterhU6 and hUbCAvailable SinceApril 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-link-ytdTomato-URA3
Plasmid#168054PurposeReplaces Addgene plasmid 118461. Yeast tagging vector to create a gene fusion with yeast optimized tdTomato with CaUra3 selection; Contains the linker region at the 5’ end of the FPDepositorInsertytdTomato
TagsytdTomatoExpressionYeastAvailable SinceJune 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEJS1099: Dual-sgRNA.Design 4
Plasmid#159537PurposeDelivery of dual sgRNA cassettes and Nme2Cas9 in a single AAV vectorDepositorInsertNme2Cas9 with two guide RNA cassettes
UseAAV, CRISPR, and Mouse TargetingTagsNLSExpressionMammalianPromoterU1aAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
C321.∆A.opt
Bacterial Strain#87359PurposeThis is C321.∆A with additional mutations engineered by Kuznetsov et al. to improve doubling time.DepositorBacterial ResistanceGentamicinSpeciesSyntheticAvailable SinceMay 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRCA905 - KLF4 Puro-T2A-BFP (pRCA847 backbone)
Plasmid#238185PurposeLentiviral vector for overexpression KLF4 ORF from a EF1a promoterDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
LRG2.1_Puro
Plasmid#125594PurposeLentiviral expression of sgRNA with GFP and puromycin resistance geneDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 promoter for sgRNA expression and EFS promoter…Available SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-postASAP
Plasmid#178792PurposeExpresses voltage sensor targeted to dendrites and spinesDepositorInsertFingR.PSD95 and ASAP2f
ExpressionMammalianMutationmutations in amino acids L146G, S147T N149R, S150…PromoterCAGAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX305_3xFLAG_STAT1
Plasmid#220323PurposeExpresses full length human STAT1 with an N-terminal 3xFLAG tagDepositorAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRNA
Plasmid#71409PurposeThere is no gene/insert. It is a backbone plasmid that others can use to insert sgRNAs of interest. The cloning site for this BsmBIDepositorTypeEmpty backboneUseLentiviralAvailable SinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
Flag-HA-USP18
Plasmid#22572DepositorAvailable SinceNov. 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
pmTurquoise2-Golgi
Plasmid#36205PurposeIn vivo visualization of golgi apparatus (can be used for colocalization studies)DepositorAvailable SinceAug. 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
HNF4A_P2-2200
Plasmid#31062DepositorInsertHNF4A P2 promoter (HNF4A Human)
UseLuciferaseExpressionMammalianMutation-2200 to -1 of P2 HNF4A promoterAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-hMLN
Plasmid#27079PurposeNon-integrating (episomal) expression of human C-MYC, LIN28 and NANOGDepositorInsertC-MYC, LIN28, NANOG (MYC Human)
ExpressionMammalianAvailable SinceMay 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
U6-5'+3' MS2-CircRNA
Plasmid#213752PurposeFor circular RNA-mediated prime editor using U6-5'+3' MS2-CircRNA in HEK293T cellsDepositorInsert5' ribozyme, 5' ligation sequences, 5' MS2, 3' MS2, 3' ligation sequences, 3' ribozyme
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H187
Plasmid#170348PurposemT2Del_EPACdDEPCD_Q270E_tdcp173Ven(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmT2Del_EPACdDEPCD_Q270E_tdcp173Ven(ST) (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceJuly 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-EGFP (AAV2 trial size)
Viral Prep#50465-AAV2.TPurposeReady-to-use AAV2 trial size particles produced from pAAV-hSyn-EGFP (#50465). In addition to the viral particles, you will also receive purified pAAV-hSyn-EGFP plasmid DNA. hSyn-driven EGFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEGFPAvailable SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABEpuro-ERBB2 S310F
Plasmid#40991DepositorAvailable SinceNov. 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
TB201
Bacterial Strain#230031PurposeFluorescently labelled (YFP) E. coliDepositorBacterial ResistanceNoneAvailable SinceFeb. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 HA 14-3-3 sigma
Plasmid#11946DepositorAvailable SinceMay 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLNCX2-Scrib
Plasmid#24600DepositorInsertScribble (SCRIB Human)
ExpressionMammalianAvailable SinceApril 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLenti4/TO-hEPO
Plasmid#50437Purposeexpress human erythropoietin under the control of tetracycline-regulatable CMV promoter using lentiviral delivery systemDepositorInsertEPO (EPO Human)
UseLentiviral; Tetracycline-regulatable (t-rex)ExpressionMammalianPromoterCMV/TOAvailable SinceJan. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTagRFP657-N1
Plasmid#31959DepositorInsertTagRFP657
ExpressionMammalianAvailable SinceSept. 12, 2011AvailabilityAcademic Institutions and Nonprofits only -
-
PET-WT SpCas9-NLS-6xHis
Plasmid#207373PurposeExpression of increased-fidelity (i.e. high-fidelity) SpCas9 variant in bacterial cellsDepositorInsertWT SpCas9
UseCRISPRTags6xHisExpressionBacterialPromoterT7Available SinceSept. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV Sport2 mPer2
Plasmid#16204DepositorInsertPer2 (Per2 Mouse)
ExpressionMammalianAvailable SinceDec. 6, 2007AvailabilityAcademic Institutions and Nonprofits only