We narrowed to 12,388 results for: shRNA
-
Plasmid#184835PurposeConstitutive expression of single-spacer CRISPR array with non-targeting spacer for PgiCas13b in bacteria.DepositorInsertConstitutive expression of single-spacer CRISPR array with a nontargeting spacer for PgiCas13b in bacteria.
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119Available SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pDECKO_Malat1_C
Plasmid#72622PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGCP123-GFP_g1
Plasmid#153518PurposesgRNA to GFP gene (NT) under nisin-inducible nisA promoter, barcodedDepositorInsertPnisA-sgRNA(GFP_g1)_dCas9 scaffold (barcoded)
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_TOP1
Plasmid#183323PurposeAll-in-One CRISPRko system with a guide RNA that targets TOP1 geneDepositorInsertTOP1
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
gRNA-leu-HYB
Plasmid#64332Purposeleu2 deletion gRNA cassette carried by pRS42HDepositorInsertgBlock product of leu2 deletion gRNA cassette
ExpressionYeastAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
RRM1 E1.3 gRNA
Plasmid#90880Purpose3rd generation lentiviral gRNA plasmid targeting human RRM1DepositorInsertRRM1 (Guide Designation E1.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_Malat1_A
Plasmid#72620PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-sgHPDL #9
Plasmid#174166Purposeknock out HPDL in human cell linesDepositorInsertsgRNA against HPDL
UseLentiviralExpressionMammalianAvailable SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-PXN
Plasmid#227315PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of PXN for knock-in.DepositorAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMGIB-3xFLAG-pontin
Plasmid#53608PurposeRetroviral expression of human pontinDepositorInsertpontin (RUVBL1 Human)
UseRetroviralTags3xFLAGExpressionMammalianMutationpontin CDS mutated to confer resistance to shRNA.…PromoterLTRAvailable SinceJune 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
gRNA-his-HYB
Plasmid#64333Purposehis3 deletion gRNA cassette carried by pRS42HDepositorInsertgBlock product of his3 deletion gRNA cassette
ExpressionYeastAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_PELO
Plasmid#127124DepositorInsertgRNA PELO (PELO Human)
UseCRISPRAvailable SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_FGFR3
Plasmid#183291PurposeAll-in-One CRISPRko system with a guide RNA that targets FGFR3 geneDepositorInsertFGFR3
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_AAVS1A
Plasmid#183337PurposeAll-in-One CRISPRko system with a guide RNA that targets the AAVS1 locusDepositorInsertAAVS1A
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_G3BP1_G1
Plasmid#127114DepositorInsertgRNA G3BP1 (G3BP1 Human)
UseCRISPRAvailable SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJZC588
Plasmid#62315PurposesgRNA with 2x MS2 (wt+f6) for yeast cellsDepositorInsertsgRNA + 2x MS2 (wt+f6) binding module
ExpressionYeastPromoterSNR52Available SinceApril 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
LL - hOCT4i -2
Plasmid#12197DepositorAvailable SinceSept. 6, 2006AvailabilityAcademic Institutions and Nonprofits only