We narrowed to 1,708 results for: CAG promoter
-
Plasmid#245523PurposePlasmid for PiggyBac /ITR mediated insertion of F-Tractin sequence downstream of CAG promoter using Gateway recombination cassetteDepositorInsertF-Tractin-mKate2
ExpressionMammalianAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
APX1-pm-eGFP
Plasmid#245520PurposePlasmid for PiggyBac /ITR mediated insertion of pm-eGFP downstream of CAG promoter using Gateway recombination cassetteDepositorInsertpm-eGFP
ExpressionMammalianAvailable SinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-chGrb2/eDHFR(69K6)-iRFP713
Plasmid#214828PurposeEncoding Grb2-eDHFR(69K6) chimera fused to iRFP713DepositorInsertGrb2(1-59)-eDHFR(69K6)-Grb2(152-216)-iRFP713
TagsiRFP713ExpressionMammalianPromoterCAG promoterAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Neo-GFP/empty
Plasmid#105505PurposeEmpty backbone of MSCV-driven retroviral cDNA expressionDepositorTypeEmpty backboneUseRetroviralAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
LADL Bridge + Target Zfp462-Klf4SE
Plasmid#127668PurposeEncodes for CRY2-HA and mCherry proteins expressed from the EF1a promoter; 2 gRNAs targeting the Zfp462 promoter and 2 gRNAs targeting the Klf4 SE expressed from their individual hU6 promotersDepositorInsertCRY2-HA-2A-mCherry and gRNAs 129, 135, 115 and 117
UseCRISPRTagsHAExpressionMammalianPromoterEF1a and hU6Available SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On shYap1-4
Plasmid#193670PurposeTet inducible knockdown of Yap1DepositorInsertYap1 (Yap1 Mouse)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shRBFOX1-3261
Plasmid#115458PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shCIAP2-A
Plasmid#44130DepositorInsertCIAP2
UseLentiviral and RNAiExpressionMammalianAvailable SinceApril 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV:AsCpf1-2A-GFP-U6-AAVS1-sg
Plasmid#194716PurposeBicistronic vector expressing CMV promoter driven AsCpf1, and U6 promoter driven guide RNA that target hAAVS1 locusDepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMH184
Plasmid#122857PurposeMS2-modified guide RNA targeting the FT promoter with GreenGate E-F flanking sequencesDepositorInsertMS2-modified sgRNA targeting the Arabidopsis FT promoter
UseGolden gate compatible cloning vectorAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti KO CLDN1 2xgRNA - spCas9 iRFP670 puro
Plasmid#166133PurposeThis plasmid allows efficient KO of the cldn1 gene, while expressing the far red fluorescent protein iRFP670 and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting cldn1 gene
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianAvailable SinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
KJ740(DE3)
Bacterial Strain#179486PurposeKJ740(DE3) is an OmpC-, OmpF-deletion strain of E. coli that allows for T7 promoter-based expressionDepositorBacterial ResistanceTetracycline (chromosome, Tn10) (10 μg/mL); Streptomycin/Spectinomycin (chromosome) (50 μg/mL)SpeciesEscherichia coliAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-Rictor-shRNA
Plasmid#157930PurposeKnockdown of RictorDepositorInsertRictor shRNA
UseLentiviral and RNAiTagstdTomatoPromotermouse U6Available SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - AAVS1 sgRNA
Plasmid#70661PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an AAVS1-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorInsertsgRNA against AAVS1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shTRAF2#1
Plasmid#44127DepositorInsertTRAF2 (TRAF2 Human)
UseLentiviral and RNAiAvailable SinceMarch 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shTRAF2#2
Plasmid#44128DepositorInsertTRAF2 (TRAF2 Human)
UseLentiviral and RNAiAvailable SinceMarch 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBT009.119.DA9
Plasmid#206803PurposeExpresses DA9 scRNA for activation of pDA303DepositorInsertDA9 scRNA
PromoterJ23119Available SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pB-puro-mU6-RtcAshRNA1
Plasmid#126613PurposeExpresses shRNA against human RtcA under mouse U6 promoterDepositorInsertRtcA shRNA-1
UseRNAiPromotermouse U6 promoterAvailable SinceJune 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pB-puro-mU6-RtcAshRNA2
Plasmid#126614PurposeExpresses shRNA against human RtcA under mouse U6 promoterDepositorInsertRtcA shRNA-2
UseRNAiPromoterMouse U6 promoterAvailable SinceJune 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7 Alk.2 shRNA
Plasmid#59297PurposeshRNA to mouse AlkDepositorInsertAlk.2 shRNA
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromotermouse U6Available SinceAug. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EP400
Plasmid#226449PurposeFor subcloning of human EP400 promoter or for assays using M13 phageDepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
Gg 3kb Green opsin GFP
Plasmid#72919Purposegreen opsin promoter from chicken (Gallus gallus) gDNA chr26:4,504,913–4,501,931 in galGal4 driving GFPDepositorInsertchicken green opsin promoter
Available SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSuper-Rem2-2
Plasmid#51595PurposeshRNA 2 against rodent Rem2DepositorAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
hIRF-1 gRNA #409 (Sa)
Plasmid#98134PurposeExpresses a guide RNA (gRNA) to target human IRF-1 promoter for the Sa-Cas9 systemDepositorInsertgRNA_hIRF1 promoter #409
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
hIRF-1 gRNA #351 (Sa)
Plasmid#105283PurposeExpresses a guide RNA (gRNA) to target human IRF-1 promoter for the Sa-Cas9 systemDepositorInsertgRNA_hIRF1 promoter #351
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
Gg 3kb Green opsin DsRed
Plasmid#72918Purposegreen opsin promoter from chicken (Gallus gallus) gDNA chr26:4,504,913–4,501,931 in galGal4 driving DsRedDepositorInsertchicken green opsin promoter
Available SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA-puro
Plasmid#180426PurposeExpresses puromycin resistance gene and scrambled gRNA for stable integration in mammalian cells; useful as control and template for new gRNAs by mutagenesis.DepositorInsertgRNAscr
UseCRISPR and LentiviralExpressionMammalianPromoterhuman U6Available SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
LRG/Foxa1 e2.4
Plasmid#105511PurposeLentiviral expression of Foxa1 DNA-binding domain (exon 2) targeting sgRNADepositorInsertFoxa1 (sgRNA, e2.4)
UseLentiviralAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR2
Plasmid#167001PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCELF4-4405
Plasmid#115466PurposeConstitutive lentiviral expressionDepositorAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
LRG/Rosa26
Plasmid#105510PurposeLentiviral expression of Rosa26 targeting sgRNADepositorInsertRosa26 (Gt(ROSA)26Sor Mouse)
UseLentiviralAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shMBNL3-9465
Plasmid#115464PurposeConstitutive lentiviral expressionDepositorAvailable SinceOct. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-Nono-sh1
Plasmid#127650PurposeKnock-down of human NONODepositorInsertNONO shRNA (NONO Human)
UseLentiviralAvailable SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
shERK2a-mlpx-puro
Plasmid#65229Purposeencodes a shRNA against ERK2DepositorInsertshRNA against ERK2 (MAPK1 Human)
ExpressionMammalianAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
px330 p300 gRNA
Plasmid#165591PurposeInsertion of p300 degronDepositorAvailable SinceMarch 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
lentiCRISPR - DDX3Y sgRNA 1
Plasmid#70656PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a DDX3Y targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against DDX3Y
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTX198
Plasmid#89262PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsPDS gene, OsPDS-gRNA01DepositorInsertOsPDS-gRNA01
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C9orf114 sgRNA 1
Plasmid#70655PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C9orf114 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C9orf114
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C9orf114 sgRNA 2
Plasmid#70654PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C9orf114 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C9orf114
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTX203
Plasmid#89267PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsDEP1 gene, OsDEP1-gRNA02DepositorInsertOsDEP1-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
sUPRa
Plasmid#223242PurposesUPRa is a dual promoter and two-color construct, which is designed to report the global unfolded protein response (UPR) and affords unbiased cell detection irrespective of UPR levelsDepositorInsertsUPRa
UseAAVPromoterCustomAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBT267_(pCA-ATG-intron-tTA2-TRE-tdT3Myc)
Plasmid#36879DepositorInsertstTA2
tdT-3Myc
Tags3 Myc tagsExpressionMammalianMutationinsertion of a beta-globin intron with a loxP sit…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 8, 2012AvailabilityAcademic Institutions and Nonprofits only -
JPF0446
Plasmid#124022PurposeBxBI Destination vector with H2B::GFP expressed from CAG promoterDepositorInsertBXBI_pCAG-H2B::msfGFP-bghpA
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPD766 TRE3GV DsRE2 in TUPV1
Plasmid#253881PurposeComponents for Integration Vectors: mMoClo TUPV, with TRE3GV promoter and DsRe2 in the MCSDepositorInsertDsRE2
UseSynthetic BiologyExpressionMammalianPromoterTRE3GVAvailable SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD769 TRE3GV HIF1a in TUPV2
Plasmid#253882PurposeComponents for Integration Vectors: mMoClo TUPV, with TRE3GV promoter and HIF1a* in the MCSDepositorInsertHIF1a*
UseSynthetic BiologyExpressionMammalianPromoterTRE3GVAvailable SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD1043 TRE3GV mTagBFP2
Plasmid#253903PurposeComponents for Integration Vectors: mMoClo TUPV, with TRE3GV promoter and mTagBFP2 in the MCSDepositorInsertmTagBFP2
UseSynthetic BiologyExpressionMammalianPromoterTRE3GVAvailable SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only