We narrowed to 7,298 results for: mCherry
-
Plasmid#44514DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationThree tandem tet operators (3XtetO2) downstream o…PromoterPGal1-T123 promoterAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only
-
pCRI011-pYFAC-pyroA-PgpdA-4xcrRNAarrayelcA-TtrpC
Plasmid#140203PurposeFungal vector to express an LbCas12a crRNA array targeted to Pelca, to be contransformed with pCRI009 containing PelcA-mCherry in a dLbCas12a-VPR strain as proof-of-concept of CRISPRa.DepositorInsertcrRNA array elcA
UseCRISPR and Synthetic BiologyPromoterPgpdAAvailable SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDN-G1TCbt
Plasmid#44515DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationTwo tandem tet operators (2XtetO2) downstream of …PromoterPGal1-D12 promoterAvailable SinceApril 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
ECON
Plasmid#82553PurposeEpigenetic effector construct for targeted methylationDepositorTagsHALO and mCherryExpressionMammalianMutationN-terminal photolyase homology region domain of C…PromoterCMVAvailable SinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC77
Plasmid#62338PurposesgRNA (no RNA aptamer addition) with COM-KRAB effector for mammalian cellsDepositorInsertssgRNA
COM-KRAB
UseLentiviralTagsKRABExpressionMammalianMutationTargets sv40 promoter, sequence: CATACTTCTGCCTGCT…PromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC101
Plasmid#62335PurposesgRNA (no RNA aptamer addition) with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
LIC-Z-YFP
Plasmid#153544Purposeperform light induced optogenetic clustering of TCR ζ-Chain tagged with yellow fluorescent protein as described in the associated publicationDepositorInserthuman TCR ζ-Chain (CD247 Human)
TagsVenus YFPExpressionMammalianMutationwith mCherry in LIC-Z replaced by YFPPromoterCMVAvailable SinceJuly 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-AnillinA740D, E758K
Plasmid#187273PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin A740D,E758KDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationAnillin A740D, E758KPromoterU6, CMVAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6gT28.13.EFS-NS.H2B-RFP
Plasmid#170388PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 13. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralPromoterEFS-NSAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJZC73
Plasmid#62341PurposesgRNA (no RNA aptamer addition) with COM-KRAB effector for mammalian cellsDepositorInsertssgRNA
COM-KRAB
UseLentiviralTagsKRABExpressionMammalianMutationTargets sv40 promoter, sequence: GAATAGCTCAGAGGCC…PromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMCh2007_pLenti_Syn_mChe-cdc42E7
Plasmid#118620Purposeexpression of mChe-tagged cdc42E7 under pSyn promoter for primary neuronsDepositorInsertcdc42E7 (Cdc42 Mouse)
UseLentiviralTagsmCherryExpressionMammalianMutationchanged cagtctg to ggcataa (667 - 673 nt in 3…Promotersynapsin I (rat)Available SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Gal4-entry
Plasmid#128014PurposeVector containing the Gal4-entry expression cassette and a separate expression cassette driving mCherry via the traffic jam enhancerDepositorInsertGal4-DBD-3xFlag
UseGal4 entry vectorTagsGal4-DBD-3xFlagAvailable SinceAug. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
p3-HPRT1-S104R-PdTK-mCh
Plasmid#107276PurposeHPRT1 c.312C>A Munich donor vector with unilateral microhomologyDepositorInsertsMutationc.306G>T, c.312C>AAvailable SinceMarch 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
p3-HPRT1-S104Rf-PdTK-mCh
Plasmid#107277PurposeHPRT1 c.312C>A (Munich) donor vector with bilateral microhomologyDepositorInsertsMutationc.306G>T, c.312C>AAvailable SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCVL.SSA TLR (Ani)
Plasmid#45577PurposeCodes for the SSA-TLR with the target site for I-Ani I in a lentiviral backboneDepositorInserts5' iRFP arm
eGFP with I-Ani I TS
+3 mCherry
3' iRFP arm
UseLentiviralExpressionBacterial and MammalianMutationembedded I-Ani I TS from 163-185bp, truncated 25 …PromoterSFFVAvailable SinceNov. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCAG-RFP-mouse Tet1 (pc2329)
Plasmid#246848PurposeExpresses mRFP tagged mouse Tet1 in mammalian cells. N-terminal tagged to mCherry.DepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMDS1
Plasmid#239460PurposeFor simultaneous monitoring of both transcription and translation of genes in plant tissues: C-terminus fusionDepositorTypeEmpty backboneTagsVENUS:3xHA:2A:mTurqN7ExpressionBacterial and PlantAvailable SinceOct. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
AP2u2-CMV-S_protein
Plasmid#226456PurposeMammalian expression of S protein of SARS-CoV2 under CMV promoter, tagged with 6His and released extracellular environment after expression for protein purificationDepositorInsertSpike Protein
Tags6xHis Tag, Foldon Domain, and Thrombin Cleavage S…ExpressionMammalianAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMBS-838
Plasmid#217994PurposepLEXSY_I-blecherry3_dom_lacZ Destination VectorDepositorTypeEmpty backboneUseSynthetic BiologyPromoterT7 promotorAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pD002
Plasmid#198833PurposeInhibition of synaptic vessel release due to disruption of synaptic vessel function by reactive oxygen species production.DepositorInsert15xUAS::miniSOG-103L-mCherry::let-858 3'UTR
ExpressionWormAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD2529-CAG-b3 N305T
Plasmid#189798PurposeExpression of full length human integrin beta 3 with N305TDepositorAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVX-anti-MIR328-3p
Plasmid#153319PurposeExpresses zsGreen fused to a miR-328-3p sponge and mCherry in mammalian cells.DepositorInsertzsGreen with MIR328-3p sponge
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVX-anti-MIR211-5p
Plasmid#153318PurposeExpresses zsGreen fused to a miR-211-5p sponge and mCherry in mammalian cells.DepositorInsertzsGreen with MIR211-5p sponge
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.4.hSyn.flex.H2B.RFP
Plasmid#170386PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 4. Cre-inducible expression of nuclear RFP.DepositorInsertCre inducible H2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.3.hSyn.flex.H2B.RFP
Plasmid#170374PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 3. Cre-inducible expression of nuclear RFP.DepositorInsertCre inducible H2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.3.hSyn.H2B.RFP
Plasmid#170370PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 3. Expressing nuclear RFP.DepositorInsertH2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.13.hSyn.flex.H2B.RFP
Plasmid#170376PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 13. Cre-inducible expression of nuclear RFP.DepositorInsertCre inducible H2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.13.hSyn.H2B.RFP
Plasmid#170372PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 13. Expressing nuclear RFP.DepositorInsertH2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6gT28.4.EFS-NS.H2B-RFP
Plasmid#170365PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 4. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralPromoterEFS-NSAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only