We narrowed to 14,904 results for: EGF
-
Plasmid#121800PurposepMVP L3-L2 entry plasmid, contains HA tag-polyA + CMV-eGFP-P2A-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds C-term HA tag to gene plus downstream CMV-driven GFP-P2A-TETaDepositorInsertHA epitope tag-polyA + CMV::eGFP-P2A-TETa-polyA
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-FRT-FLEX-GtACR2-KA2N-EGFP
Plasmid#114378Purposeexpresses Flpo recombinase-dependent GtACR2-KA2N, which targets GtACR2 to the somatodendritic compartmentDepositorAvailable SinceAug. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBEST-p70a-UTR1-deGFP Y35TAG-6xHis-T500
Plasmid#92225PurposeExpression of deGFP mutant Y35TAG for ncAA incoporation using the p70a promoter and UTR1DepositorInsertdeGFP Y35TAG
UseSynthetic Biology; Cell free protein synthesis (c…Tags6xHisExpressionBacterialMutationResidue Y35 mutated into TAG (Amber) stop codon f…Promoterp70aAvailable SinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBEST-p15A-OR2-OR1-Pr-UTR1-deGFPT500 (121p)
Plasmid#70197PurposePromoter panelDepositorInsertdeGFP
Available SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCru5-ACC/ACC/ACC-mEGFP-IRES-mCherry
Plasmid#49219PurposeRetroviral expression vector. Contains an altered Kozak sequence and/or upstream open reading frames to modulate expression at the level of translation.DepositorInsertsmEGFP
mCherry
UseRetroviral and Synthetic BiologyTagsSfuI site to create C-terminal fusionsExpressionMammalianPromoterViral LTR (or CMV)Available SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
EGFP G protein Gamma 3(A73L,L74I,L75S) in pcDNA3.1
Plasmid#42190DepositorInsertG protein Gamma 3(A73L,L74I,L75S) (Gng3 Mouse)
TagsEGFPExpressionMammalianMutationA73L,L74I,L75SPromoterCMVAvailable SinceMarch 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJEP323-pAAV-FullH1TO-SaCa9gRNAi(SapI)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA Empty Cassette
Plasmid#113700PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette without a gRNA. Followed by an EFS driven GFP-KASH in a separate reading frame. SapI can be used to clone in a gRNAs.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pc5139-pEGFP-H3.1-K36M
Plasmid#241430PurposeExpresses human Histone H3.1 as fusion to GFP with lysine to methionine point mutation of K36 from plasmid H3.1 using primers: forward: ACCGGTGGCGTGATGAAACCTCATCGC & reverse: GCGATGAGGTTTCATCDepositorInserthuman Histone H3.1 (H3C1 Human)
TagsEGFPExpressionMammalianMutationlysine at position 36 to methionine (K36M)PromoterCMVAvailable SinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
mCherry-TOP1-GFP-pEGFP-N1
Plasmid#238377PurposeExpresses mCherry-DNA Topoisomerase 1-GFP in mammalsDepositorAvailable SinceMay 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS_internal PA-TubA1A-IRES-EGFP
Plasmid#255804Purposemammalian expression of PA-tagged human TubA1A(E254A). The PA tag (GVAMPGAEDDVV) is inserted between Ile42 and Gly43 in the flexible loop of TubA1A. An IRES drives expression of EGFP reporter.DepositorAvailable SinceMay 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV-Gfa2-VIVIT-EGFP
Plasmid#254430PurposeFor production of AAV containing VIVT-EGFPDepositorInsertVIVIT-Green Fluorescent Protein
UseAAVPromoterGfa2Available SinceMay 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
pIRES2-EGFP-hEAG1-Variant 2
Plasmid#253764PurposePlasmid for expression of the wildtype human EAG1/KCNH1, isoform 2 with an IRES-EGFP serving as reporter.DepositorAvailable SinceMay 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pIRES2-EGFP-hEAG1-Variant 1
Plasmid#253763PurposePlasmid for expression of the wildtype human EAG1/KCNH1, isoform 1 with an IRES-EGFP serving as reporter.DepositorAvailable SinceMay 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAVS-EGFP^PTC-231
Plasmid#254989PurposeExpress EGFP^PTC-231 in mammalian cellsDepositorInsertEGFP^PTC-231
ExpressionMammalianMutationNAAvailable SinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
tetOFF-EGFP^PTC-231
Plasmid#254991PurposeExpress doxycycline-repressive EGFP^PTC-231 in mammalian cellsDepositorInsertEGFP^PTC-231
ExpressionMammalianMutationNAAvailable SinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
HaloTag-eGFP-OMP25(MTS)
Plasmid#188661PurposeHaloTag-GFP fusion targeted to mitochondria with OMP25 targeting sequence.DepositorInsertGFP-HALO-OMP25(MTS)
ExpressionMammalianPromoterChicken beta actinAvailable SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
MTS-ABE8e(∆HNH)-EGFP
Plasmid#251974PurposeMitochondrial ABE with HNH truncatedDepositorInsertABE8e
UseCRISPRTagsMTS and V5-P2A-EGFPExpressionYeastMutationHNH deletedPromoterGPDAvailable SinceApril 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
MTS-ABE8e(∆REC2)-EGFP
Plasmid#251975PurposeMitochondrial ABE with REC2 truncatedDepositorInsertABE8e
UseCRISPRTagsMTS and V5-P2A-EGFPExpressionYeastMutationREC2 deletedPromoterGPDAvailable SinceApril 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pscAAV- EF1α core -EGFP
Plasmid#246994PurposeCan be used to generate AAV virus that will express EGFP from EF1α core promoterDepositorInsertEGFP
UseAAVPromoterEF1αAvailable SinceApril 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-MeCP2-R168X (pc4748)
Plasmid#248577PurposeMammalian expression plasmid of MeCP2-R168X (aa1- aa167)DepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-MeCP2-R255X (pc4749)
Plasmid#248578PurposeMammalian expression plasmid of MeCP2-R255X (aa1- aa254)DepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TRE3GS-eGFP
Plasmid#252871PurposeTRE3GS expression plasmid for Flp/FRT recombination expressing eGFPDepositorInserteGFP
ExpressionMammalianPromoterTRE3GSAvailable SinceMarch 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-HSV
Plasmid#242769PurposeAAV transfer plasmid expressing eGFP-HSV under a CAG promoter.DepositorInsertEGFP
UseAAVTagsHSVPromoterCAGAvailable SinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
FRB-mUSH1C-DFCR-pEGFP
Plasmid#251431PurposeMammalian expression vector for expressing the actin-binding motif of mouse harmonin b with an N-terminal FRB and a C-terminal EGFPDepositorInsertThe DFCR fragment (residues 296-728 of Ush1C) (Ush1c Mouse)
TagsEGFP and FRBExpressionMammalianAvailable SinceMarch 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Tet-O-FUW-EGFP-PURO
Plasmid#251732PurposeOverexpression construct expressing EGFP-PURO and ORF-BCDepositorInsertEGFP
UseLentiviralAvailable SinceMarch 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP EGFP-mouse Fis1
Plasmid#252262PurposeRetroviral expression of EGFP-mouse Fis1DepositorAvailable SinceFeb. 24, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1_N-NLS_POLH_ΔGG NEDD8
Plasmid#221870PurposeExpresses GFP-tagged WT POLH fused to ΔGG NEDD8 in mammalian cellsDepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1_N-NLS_D652A POLH
Plasmid#221871PurposeExpresses D652A POLH with an N-terminal NLS-GFP tag in mammalian cellsDepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1_N-NLS_K682A_K686A_K694A_K709A POLH
Plasmid#221872PurposeExpresses K682A_K686A_K694A_K709A POLH with an N-terminal NLS-GFP tag in mammalian cellsDepositorInsertPOLH (POLH Human)
TagsNLS-EGFPExpressionMammalianMutationK682A, K686A, K694A, K709APromoterCMVAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1_N-NLS_L704A_F707A_F708A POLH
Plasmid#221873PurposeExpresses PIP box-mutated POLH with an N-terminal NLS-GFP tag in mammalian cellsDepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only