We narrowed to 13,024 results for: sgrna
-
Plasmid#195109PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting the RPB1 C-term. Puromycin selection (2A-fusion).DepositorInsertsgRNA against last exon of RPB1 (C-terminal)
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-Puro HLAG-2A-sgRNA
Plasmid#182551PurposeCas9 from S.pyogenes with 2A-Puro, and the 2A-sgRNA to targeting exon 2 of human HLA-G geneDepositorInserthSpCas9-2A-Puro-HLAG-2A-sgRNA
UseCRISPRExpressionMammalianPromoterCbhAvailable SinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
SauCas9 EMX1-nicking sgRNA
Plasmid#169860PurposeSauCas9 nicking sgRNA for EMX1DepositorInsertSauCas9 EMX1-nicking sgRNA
ExpressionMammalianPromoterhuman U6 promoterAvailable SinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTBL437 AAVS1 EQR sgRNA
Plasmid#126447PurposeTo cut the human AAVS1 locus for integration.DepositorInsertspacer against human AAVS1 safe-harbor locus with NGAG PAM
ExpressionMammalianPromoterhuman U6Available SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA Oct4A -12
Plasmid#50921PurposeU6 driven sgRNA targeting OCT4 isoform A -12 bp from TSSDepositorAvailable SinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pM115: CasRx control presgRNA
Plasmid#166867PurposeU6-driven expression of control (non-targeting) presgRNA compatible with CasRx.DepositorInsertnon-targeting presgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(-10TC)_Psyn-sgRNA500
Plasmid#149583Purposeparental, all-in-one CRISPRi vector for B. burgdorferi, parental for gRNA cloningDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgRNA scaffold-spacer-human U6
Plasmid#214697Purposeprovide "sgRNA scaffold-spacer-human U6" fragmentDepositorInsertsgRNA scaffold-spacer-human U6
UseCRISPRAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA4-CTCF-3p-UTR
Plasmid#195106PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting downstream of the human CTCF 3'UTR. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF 3' UTR region
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA3-CTCF-3p-UTR
Plasmid#195105PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting downstream of the human CTCF 3'UTR. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF 3' UTR region
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA2-CTCF-prom
Plasmid#195104PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting upstream of the human CTCF promoter. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF promoter
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA1-CTCF-prom
Plasmid#195103PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting upstream of the human CTCF promoter. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF promoter
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA3-RPB1-N-term
Plasmid#195112PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting the RPB1 N-term. Puromycin selection (2A-fusion).DepositorInsertsgRNA against first exon of RPB1 (N-terminal)
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA1-RPB1-N-term
Plasmid#195110PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting the RPB1 N-term. Puromycin selection (2A-fusion).DepositorInsertsgRNA against first exon of RPB1 (N-terminal)
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-ANLN_sgRNA
Plasmid#183876PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and ANLN sgRNA for N-terminal tagging of anillin in human cells.DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAs-Cpf1-pGL3-U6-sgRNA
Plasmid#107683PurposeExpresses AsCpf1 crRNA in mammalian cellsDepositorInsert
ExpressionMammalianAvailable SinceApril 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lentiviral sgRNA human CD19
Plasmid#155289PurposeLentiviral expression of sgRNA against human CD19DepositorInsertCD19 (CD19 Human)
Available SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-ACTB_sgRNA
Plasmid#183884PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and ACTB sgRNA for N-terminal tagging of beta-actin in human cells.DepositorAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-TUBA1B_sgRNA
Plasmid#183888PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and TUBA1B sgRNA for N-terminal tagging of alpha-tubulin in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-RHOA_sgRNA
Plasmid#183877PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and RHOA sgRNA for N-terminal tagging of RhoA in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc-sgRNA-Cas9.scr_2
Plasmid#190704PurposeExpresses scrambled sgRNA and Cas9-Puro in Drosophila S2 cellsDepositorInsertScrambled sgRNA 2
UseCRISPRExpressionInsectPromoterDrosophila U6Available SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV Gsk3 sgRNA/GFP
Plasmid#112733PurposeGsk3b targeting gRNA cloned into px552 (SpGuide) plasmid.DepositorInsertGFP
UseAAV and CRISPRExpressionMammalianAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSico_U6-Pan-PGC1a sgRNA
Plasmid#165426PurposeExpression of gRNA against human Total PGC-1a variantsDepositorInsertgRNA against human Total PGC-1a variants (PPARGC1A Synthetic, Human)
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(-10AC12)_Psyn-sgRNArodA
Plasmid#149661Purposeall-in-one CRISPRi vector for targeting B. burgdorferi rodADepositorInsertdCas9, lacI, sgRNArodA
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30(-10AC12), PsynAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(RBSmut)_Psyn-sgRNAflaB
Plasmid#149588Purposeall-in-one CRISPRi vector for targeting B. burgdorferi flaBDepositorInsertdCas9, lacI, sgRNAflaB
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(RBSmut)_Psyn-sgRNAftsI
Plasmid#149590Purposeall-in-one CRISPRi vector for targeting B. burgdorferi ftsIDepositorInsertdCas9, lacI, sgRNAftsI
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pM116: CasRx VEGFA presgRNA
Plasmid#166868PurposeU6-driven expression of human VEGFA targeting presgRNA compatible with CasRx.DepositorInsertHuman VEGFA targeting presgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-Puro HLAG-2B-sgRNA
Plasmid#182552PurposeCas9 from S.pyogenes with 2A-Puro, and the 2B-sgRNA to targeting exon 2 of human HLA-G geneDepositorInserthSpCas9-2A-Puro-HLAG-2B-sgRNA
UseCRISPRExpressionMammalianPromoterCbhAvailable SinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-scramble
Plasmid#62285Purposeexpression of scramble sgRNA from the arabinose-inducible promoterDepositorInsertscramble sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA SOX17 -91
Plasmid#50923PurposeU6 driven sgRNA targeting Sox17 -91 bp from TSSDepositorAvailable SinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
px335-sgRNA-EF(Cas9wt)-Rif1
Plasmid#122306PurposeExpresses sgRNA targeting mouse Rif1 and Cas9 in mammalian cellsDepositorInsertsgRNA for mouse Rif1 (Rif1 Synthetic)
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(RBSmut)_Psyn-sgRNAmreB
Plasmid#149594Purposeall-in-one CRISPRi vector for targeting B. burgdorferi mreBDepositorInsertdCas9, lacI, sgRNAmreB
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
px335-sgRNA-EF(Cas9n)-Eif4a1-R
Plasmid#122345PurposeExpresses sgRNA targeting mouse Eif4a1 and Cas9 nickase in mammalian cellsDepositorInsertsgRNA for mouse Eif4a1
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
lenti-sgRNA(MS2)_zeo_hPDX1_promoter_guide1
Plasmid#176838PurposeTo induce human PDX1 expression by recruiting SAM complex to PDX1 promoterDepositorInsertsgPDX1
ExpressionMammalianPromoterU6Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - Amplicon, JAK2 sgRNA 1
Plasmid#70679PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an intergenic JAK2 amplicon-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorInsertsgRNA against JAK2 amplicon found in AML-derived HEL cell line (JAK2 )
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
SauCas9KKH CCR5-nicking sgRNA
Plasmid#169863PurposeSauCas9KKH nicking sgRNA for CCR5DepositorInsertSauCas9KKH CCR5-nicking sgRNA
ExpressionMammalianPromoterhuman U6 promoterAvailable SinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pM117: VEGFA array presgRNA
Plasmid#166869PurposeU6-driven expression of human VEGFA targeting array presgRNA compatible with CasRx.DepositorInsertHuman VEGFA targeting array presgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(RBSmut)_Psyn-sgRNArodA
Plasmid#149656Purposeall-in-one CRISPRi vector for targeting B. burgdorferi rodADepositorInsertdCas9, lacI, sgRNArodA
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Sa sgRNA expression vector
Plasmid#107720PurposeFor in vitro transcription of Sa sgRNA from the T7 promoter.DepositorTypeEmpty backboneUseCRISPRAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only