We narrowed to 22,619 results for: his
-
Plasmid#227596PurposeIntegration vector for expressing Lifeact-3xmNeonGreenDepositorInsertLifeact-3xmNeonGreen::HIS3
Tags3xmNeonGreenExpressionYeastMutationTruncated ABP140 (aa 1-17 only)PromoterAbp140Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPICZaa-STE2-cohis
Plasmid#133433PurposeYeast STE2 coding sequence in vector for inducible expression in the methanogenic yeast Pichia pastoris.DepositorInsertSTE2 (STE2 Budding Yeast)
ExpressionYeastMutationC59S/C252A, Codon optimized for P. pastoris, and …Available SinceJan. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
His6x-EX-HA-FRB-MBD_pYFJ16
Plasmid#120917PurposeExpresses His6-EX-HA-FRB-MBD in bacteria for protein purificationDepositorInsertHis6-EX-HA-FRB-MBD
ExpressionBacterialAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAS9-mCherry-HIST1H4C
Plasmid#66944PurposeCRISPaint target selector HIST1H4CDepositorInsertgRNA HIST1H4C
Available SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Histone Deacetylase 5
Plasmid#21626DepositorInsertHistone Deacetylase 5 (Tcrg-C1 Human)
ExpressionMammalianAvailable SinceJuly 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
pEG BacMam N term His8 GFP
Plasmid#160680Purposevector optimized for use in screening assays, as well as for efficient production of baculovirus and robust expression of the target proteinDepositorTypeEmpty backboneTagsHis8 GFPExpressionMammalianPromoterCMVAvailable SinceDec. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
M3929 his3::KanMX3 Disruptor Converter
Plasmid#51679PurposeYeast marker swap plasmid for converting HIS3 to KanMX3DepositorInsertKanMX3
UseYeast marker swapExpressionYeastAvailable SinceJune 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-link-yoPA-TagRFP-SpHis5
Plasmid#44854PurposeYeast tagging vector to create gene fusion with yeast optimized photoactivatable TagRFP with SpHis5 selectionDepositorInsertyoPA-TagRFP
ExpressionYeastAvailable SinceOct. 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET22b-mEB1-mCherry-6xHis
Plasmid#130984PurposeBacterial expression of mouse EB1-mCherry-6xHis for protein purification.DepositorAvailable SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
His6-SUMO-pET28a-EfaCas1
Plasmid#112793PurposeTo express enterococcus faecalis Cas1 protein in E. coliDepositorInsertEfaCas1
TagsHis6-SUMOExpressionBacterialAvailable SinceJuly 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-link-yoPSmOrange-SpHis5
Plasmid#44856PurposeYeast tagging vector to create gene fusion with yeast optimized photoconvertible mOrange with SpHis5 selectionDepositorInsertyoPSmOrange
ExpressionYeastAvailable SinceMay 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-link-yomApple-SpHis5
Plasmid#44844PurposeYeast tagging vector to create gene fusion with yeast optimized mApple with SpHis5 selectionDepositorInsertyomApple
ExpressionYeastAvailable SinceMay 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHIV-H2B-eGFP
Plasmid#91776PurposeExpresses H2B protein tagged with eGFPDepositorInsertHuman Histone H2B / eGFP (H2BC11 Human)
UseLentiviralTagseGFPExpressionMammalianPromoterEF1aAvailable SinceFeb. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET15b_6xHis-A1aY1-superTagRFP
Plasmid#255802Purposebacterial expression and purification of the synthetic protein A1aY1 which recognizes the C-terminal tail of alpha-tubulin. Tagged with superTagRFP. Based on Addgene Plasmid #158753.DepositorInsertA1aY1
Tags6xHis and superTagRFPExpressionBacterialAvailable SinceJune 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-6xHis-TFIIB-V5-BB
Plasmid#242714PurposeDoxycycline-inducible expression of double-tagged 6xHis-TFIIB-V5 (human). Construct is resistant to Dharmacon OnTarget and Accell GTF2B siRNA pools.DepositorInsertTranscription Factor IIB (GTF2B Human)
Tags6xHis and V5ExpressionMammalianMutationConstruct is resistant to Dharmacon Accell and On…PromoterTight TRE promoterAvailable SinceJune 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
PColDuet-nHis-SsDddI.dna
Plasmid#254901PurposeExpresses of Simiaoa sunii DddI(SsDddI) in BL21(DE3) cellsDepositorInsertSsDddI
Tags6xHisExpressionBacterialPromoterT7 promoterAvailable SinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pET28a-6xHis-SSF1
Plasmid#255298PurposeSSF1 (1-473) with an N-terminal 6X poly-histidine tag and a TEV recognition site sub-cloned into pET28 plasmids with Kanamycin bacterial resistance, were used for protein expressionDepositorAvailable SinceMay 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pET28a-6xHis-SURF6
Plasmid#255296PurposeSURF6 (1-361) with an N-terminal 6X poly-histidine tag and a TEV recognition site sub-cloned into pET28 plasmids with Kanamycin bacterial resistance, were used for protein expression.DepositorAvailable SinceMay 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pET29b(+)_SUMO(1-98)_sTEV_His6
Plasmid#254139PurposePlasmid for expressing Control protein construct of the AH-SUMO platfrom, without any N-terminal inducible amphipathic helix.DepositorInsertSUMO family protein SMT3 (SMT3 Budding Yeast)
ExpressionBacterialMutationContains MGSGS sequence on N-terminal of SMT3_yea…Available SinceApril 28, 2026AvailabilityAcademic Institutions and Nonprofits only