We narrowed to 11,509 results for: AGA
-
Plasmid#208383PurposeThis sgControl, located in the TP53BP1 intron, serves as a control sgRNA for the others. The vector was cloned from Lenti-sgRNA-Cre-GpNLuc.DepositorInsertsgControl (TP53BP1 intron) (Trp53bp1 Mouse)
UseLentiviral and LuciferaseExpressionMammalianMutationWTAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAED2
Plasmid#234599PurposeFluorescent reporter of the SOS responseDepositorInsertsmScarlet-I
gfp-mut2
UseReporterExpressionBacterialMutationGFPmut2 was derived from avGFP with the following…PromoterPtet+dnaK P1 and cdaAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGLS3-5xHRE-p53(K164R)
Plasmid#72555PurposeHypoxia induced mutant p53. Contains the HRE from VEGF sequence (5 repeats) upstream of p53 K164R.DepositorInsertp53 (TP53 Human)
Tags5XHREExpressionMammalianMutationK164RPromoterE1B minimal promoterAvailable SinceMarch 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMega-MaFRSA
Plasmid#200226PurposeThe plasmid encodes an orthogonal aminoacyl-tRNA synthetase/tRNA-CUA pair for amber codon suppression with meta-trifluoromethylphenylalanine..DepositorInsertsPyrrolysyl-tRNA synthetase
pyrrolysyl-tRNA
TagsnoneExpressionBacterialMutationmutated Asparagine 166 to Alanine and Valine 168 …PromoterproK-lacO and tacIAvailable SinceJune 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G2_Dual_sgRNA
Plasmid#86612PurposeVector for tandem expression of ATP1A1 G2 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos for second sgRNA using BbsI sites. Px333-like plasmidDepositorInsertATP1A1 G2 sgRNA + user-specified sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via nhej using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable SinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Bhlhe40-3xFLAG-IRES-BFP
Plasmid#117263PurposeRetroviral overexpression of Bhlhe40 with a 3xFLAGDepositorAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-αIFNα-ab
Plasmid#110799PurposeExpression and secretion of an scFv antibody (clone) 4EA1 against all mouse interferon α subtypes in mammalian cellsDepositorInsertantibody against mouse interferon alpha
TagsER signal peptide, His6 tag, and myc epitope tagExpressionMammalianPromoterCMVAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCold I-Hero45
Plasmid#187931PurposeBacterial expression of heat-resistant obscure (Hero) protein Hero45DepositorAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSCV p2GM AMPK alpha2hp1 alpha1hp1
Plasmid#89492PurposeshRNA against AMPK alpha2 and alpha1 in mouse/human to knock down protein expressionDepositorInsert2 hairpins against mouse/human AMPKalpha1 and alpha2
UseRetroviralExpressionMammalianPromoterU6 (The GFP-Puro is from a PGK promoter; the shRN…Available SinceMay 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-Bcl2-Cb5
Plasmid#18000DepositorInsertER targeted Bcl-2 (BCL2 Human)
TagsGFPExpressionMammalianMutationBcl-2's C terminal targeting sequence replac…PromoterCMVAvailable SinceJune 4, 2008AvailabilityAcademic Institutions and Nonprofits only -
GFP-Bcl2-Maob
Plasmid#18001DepositorInsertMitochondria-targeted Bcl-2 (BCL2 Human)
TagsGFPExpressionMammalianMutationBcl-2's C terminal replaced with mitochondri…PromoterCMVAvailable SinceJune 4, 2008AvailabilityAcademic Institutions and Nonprofits only -
HA-KIF5A
Plasmid#166958PurposeExpresses HA-tagged KIF5A protein in pcDNA3.1DepositorAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
A3Ai-Cas9n-UGI-NLS
Plasmid#109425PurposeExpresses human APOBEC3A containing an L1 intron fused to Cas9n, Uracil DNA Glycosylase Inhibitor, with a nuclear localization signal.DepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-Like 3A (APOBEC3A Human)
UseCRISPRExpressionMammalianMutationInsertion of an L1 intron into the coding sequenc…PromoterCMVAvailable SinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
Tom20-mChF-AIP
Plasmid#61512PurposeExpression of human FK506 binding protein 1A (FKBP1A) tagged with mCherry, Tom20, and AIPDepositorInsertFK506 binding protein 1A (FKBP1A Human)
TagsAIP, Tom20, and mCherryExpressionMammalianPromoterCMVAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
Tom20-mChF-AIP(TA)
Plasmid#61513PurposeExpression of human FK506 binding protein 1A (FKBP1A) tagged with mCherry, Tom20, and AIP with TA mutationDepositorInsertFK506 binding protein 1A (FKBP1A Human)
TagsAIP with TA mutation (see comments), Tom20, and m…ExpressionMammalianPromoterCMVAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-hsChRmine-oScarlet-KV 2.1-WPRE
Plasmid#183521PurposeOptogeneticsDepositorInserthsChRmine-oScarlet-Kv2.1
UseAAVMutationH33RPromoterCaMKIIaAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-αIFNα-ib
Plasmid#110798PurposeExpression of an intrabody derived from the monoclonal antibody 4EA1 against all mouse interferon α subtypes in mammalian cellsDepositorInsertintrabody against mouse interferon alpha
TagsER retention signal (SEKDEL), ER signal peptide, …ExpressionMammalianPromoterCMVAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28a-DDX43
Plasmid#134574PurposeExpress human DDX43 protein (WT, full-length) in E. coliDepositorAvailable SinceJan. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
Tol2 8xSTAR-mNeonGreen. PGK-puro
Plasmid#136255PurposeFluorescent reporter for intestinal stem cells through ASCL2 transcriptional activityDepositorInsertstem cell Ascl2 reporter, 8 repeats
UseTol2 transposaseTagsmNeonGreenExpressionMammalianAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only