We narrowed to 6,947 results for: KIT;
-
Plasmid#140647PurposeCTCF tagging CRISPRDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pSN672
Plasmid#177362PurposeExpresses human KIF1A(1-393) fused with leucine zipper and His tagDepositorAvailable SinceAug. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJW2098
Plasmid#163094PurposeCRISPR repair template: add insertion site specific homology arms by PCR before insertionDepositorInsert30aa linker::mScarlet (dpi)::AID*::3xFLAG::10aa linker
UseCRISPRExpressionWormMutationSilent mutations to remove piRNA sitesAvailable SinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pHSN6A01
Plasmid#50586PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-VP64, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsdCas9-VP64
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 = defective in DNA cleavage; 4×minimal VP16…Promoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
mAID-BRD4 donor
Plasmid#140650PurposeBRD4 tagging with mAIDDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
JWW-2 human chimeric monoclonal antibody
Plasmid#66749PurposeExpresses a murine/human chimeric IgG1 HPV16 L2-specific neutralizing antibody that recognizes HPV16 L2 amino acid region 58-64 . JWW-2 works in ELISA/WB/HPVDepositorInsertsJWW-2 Heavy Chain
JWW-2 Light Chain
ExpressionMammalianPromotermEF1 and rEF1Available SinceAug. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHSN6I01
Plasmid#50587PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-KRAB, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsdCas9-KRAB
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 that is defective in DNA cleavage; the maiz…Promoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
CMVp-dsRed2-Triplex-HHRibo-gRNA1-HDVRibo-pA
Plasmid#55201PurposePlasmid encoding the Ribozyme/gRNA architecture. This is a modified form of the original plasmid described in the paper (Construct 13). mKate2 was replaced with dsRed2 because of distribution issues.DepositorInsertdsRed2
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOD2044-intDEG
Plasmid#89366PurposeMosSCI targeting vector expressing a fusion between a GFP nanobody and an ubiquitin ligase adaptor ZIF-1 to degrade GFP tagged proteins. Expression is controlled by Pelt-2 (intestine specific).DepositorInsertvhhGFP4-ZIF-1 (zif-1 Nematode, Synthetic)
UseTargeting vector for mos1 transposon mediated sin…TagsvhhGFP4 (GFP nanobody)PromoterPelt-2Available SinceJune 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
GABA(A) receptor subunit g2SE
Plasmid#49170PurposepHluorin-tagged GABA A receptor subunit (gamma 2) produces minimal fluorescence during trafficking and a robust fluorescent signal at the cell surfaceDepositorInsertGABA(A) receptor subunit gamma 2 (Gabrg2 Mouse)
Tagsmyc, pHGFP (pHluorin), and thrombin cleavage site…ExpressionMammalianPromoterCMVAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
HAP40 1-371
Plasmid#124060PurposeBaculovirus expression vector for HAP40 protein (aa 1-371) in insect cellsDepositorInsertHAP40 (F8A1 Human)
UseBaculovirus expressionTags6x His and TEV cleavage sitePromoterpolyhedrinAvailable SinceApril 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
CMVp-dsRed2-Triplex-28-gRNA3-28-gRNA4-28-gRNA5-28-gRNA6-28-pA
Plasmid#55202PurposePlasmid encoding multiplexed 4x gRNAs. This is a modified form of the original plasmid described in the paper (Construct 19). mKate2 was replaced with dsRed2 because of distribution issues.DepositorInsertdsRed2
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJH127
Plasmid#162483PurposeSEC plasmid containing LG1 homology arms and myo-2p::TIR1::F2A::BFP::AID*::NLS::tbb-2 3'UTR, for expression of TIR1 and nuclear BFP reporter in C. elegans.DepositorInsertmyo-2p::TIR1::F2A::AID*::NLS::tbb-2 3'UTR
UseCRISPRTagsmyo-2p::TIR1::F2A::AID*::NLS::tbb-2 3'UTRExpressionWormAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcU6_3 MS2 sgRNA
Plasmid#92394PurposeChick-specific U6 sgRNA expression mini-vector, harbouring chick U6_3 pol III promoter, with tracrRNA scaffold containing stem loops allowing binding of bacteriophage MS2 coat protein MCPDepositorInsertchick U6.3 promoter and gRNA cloning cassette including MS2 stem loops
UseCRISPRExpressionMammalianPromoterchick U6.3Available SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
GABA(A) receptor subunit B3SE
Plasmid#49171PurposepHluorin-tagged GABA A receptor subunit (beta 3) produces minimal fluorescence during trafficking and a robust fluorescent signal at the cell surfaceDepositorInsertGABA(A) receptor subunit beta 3 (Gabrb3 Mouse)
Tagsmyc, pHGFP (pHluorin), and thrombin cleavage site…ExpressionMammalianMutationGTG (V) to TGC (C)PromoterCMVAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJH130
Plasmid#162484PurposeSEC plasmid containing LG1 homology arms and myo-3p::TIR1::F2A::BFP::AID*::NLS::tbb-2 3'UTR, for expression of TIR1 and nuclear BFP reporter in C. elegans.DepositorInsertmyo-3p::TIR1::F2A::AID*::NLS::tbb-2 3'UTR
UseCRISPRTagsmyo-3p::TIR1::F2A::AID*::NLS::tbb-2 3'UTRExpressionWormAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only