We narrowed to 15,358 results for: nts
-
Plasmid#31480DepositorInsertTraffic Light Reporter 1.1 (ani target)
UseLentiviralMutationmCherry has M9S, M16L to reduce background mCherr…Available SinceAug. 22, 2011AvailabilityAcademic Institutions and Nonprofits only -
pDR111_Bgal NLS
Plasmid#188396PurposeExpresses beta-galactosidase via Phyper-spank which is optimized for Bacillus subtilis. There is a secretion peptide (PhoD) and nuclear localization signal (SV40) that is fused to beta-galactosidase.DepositorInsertlacZ
TagsPhoD secretion peptide and SV40 NLSExpressionBacterialPromoterPhyper spankAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hMYOD1 gRNA_1-MS2-Puro
Plasmid#192673PurposeLentiviral expression of sgRNA targeting hMYOD1 promoter to activate human MYOD1 transcriptionDepositorInsertHuman MYOD1 activating gRNA #1 (MYOD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pAT-9218
Plasmid#124225PurposeBacterial SpCas9 expressionDepositorInsertSpCas9
UseCRISPRExpressionBacterialPromoterTetR/TetAAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTC394
Plasmid#91224Purposeprotoplast vector expressing gRNA24 targeting tomato ANT1 (control without TREX2 expression)DepositorInsertgRNA targeting tomato ANT1
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B2615
Plasmid#91078PurposeModule B, Promoter: AtU6, Gene: BsaI ccdb cassette for single gRNA spacer cloning, Terminator: Pol IIIDepositorInsertBsaI ccdb cassette for single gRNA spacer cloning
UseCRISPRPromoterAtU6Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5/FRT/TO_H2B_HaloTag9
Plasmid#169334PurposeNuclear expression of HaloTag9 in mammalian cellsDepositorInsertH2B-HaloTag9 (H2BC21 Human)
TagsHaloTag9ExpressionMammalianMutationHaloTag9 = HaloTag7-Q165H-P174RAvailable SinceNov. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGE463
Plasmid#153234PurposeRecipient plant transformation vector containing selection markers and a Cas9 expression cassette, but lacking guide RNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGWB421
Plasmid#74815PurposeGateway cloning compatible binary vector for N-terminal fusion with 10xMyc (CaMV35S promoter).DepositorTypeEmpty backboneExpressionPlantPromoterCaMV35SAvailable SinceOct. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET-NtLAtC60αβC20
Plasmid#160873PurposeExpression of N. tabacum Rubisco large subunit and A. thaliana Rubisco chaperone protiens cpn60α, cpn60β, cpn20 in E. coliDepositorInsertrbcL, cpn60α, cpn60β, cpn20
ExpressionBacterialPromoterrbcL: pBAD, chaperones: T7Available SinceNov. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 mir-1-1 reporter hsa-mir-133a-1
Plasmid#46676DepositorInserthsa-mir-133a-1 (MIR133A1 Human)
UseRNAiTagsV5 and hsa-mir-1-1ExpressionMammalianPromoterCMVAvailable SinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTC392
Plasmid#91223Purposeprotoplast vector expressing gRNA23 targeting tomato ANT1 (control without TREX2 expression)DepositorInsertgRNA targeting tomato ANT1
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMP71-tCD19-LLO-SIINFEKL
Plasmid#174598Purposeexpresses the extracellular and transmembrane domain of murine CD19 with a C terminal fusion of the LLO190 and SIINFEKL epitopesDepositorInsertmembrane bound CD19, LLO antigen, SIINFEKL (ovalbumin) antigen
ExpressionMammalianAvailable SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
GalT-moxDendra2
Plasmid#89789Purposemammalian expression of GC localized moxDendra2DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
(326) pAAV SV40-ZsGreen U6-gRNA
Plasmid#163020PurposeFluorescent reporter for Sa gRNA (Bsa1 sites)DepositorInsertZs Green
UseAAVExpressionMammalianPromoterSV40Available SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMOD_A0402
Plasmid#91009PurposeModule A, Promoter: AtUbi10, Gene: AtCas9_dead (D10A + H840A), Terminator: HSPDepositorInsertAtCas9_dead (D10A + H840A)
UseCRISPRMutationD10A, H840APromoterAtUbi10Available SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTX209
Plasmid#89269PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsPDS gene, OsPDS-gRNA01 and OsPDS-gRNA02DepositorInsertOsPDS-gRNA01 and OsPDS-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDGE479
Plasmid#153270PurposeM4E shuttle vector containing the Solanum lycopersicum U3 promoter for preparation of single guide RNA transcriptional units by cloning of hybridized oligonucleotides.DepositorTypeEmpty backboneUseCRISPRAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only