179,974 results
-
Plasmid#113727PurposeExpresses the fluorescent protein mNeonGreen2 in a lentiviral backboneDepositorInsertmNeonGreen2
UseLentiviralExpressionMammalianPromoterCMVAvailable sinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pET29b-IPP1-His
Plasmid#124137PurposeBacterial expression plasmid for PURE system componentsDepositorAvailable sinceApril 19, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAJ075_hsCRBN
Plasmid#124214PurposeInsect cell expression vector for His6 tagged hsCRBNDepositorAvailable sinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV CD68-hM4D(Gi)-mCherry (AAV1)
Viral prep#75033-AAV1PurposeReady-to-use AAV1 particles produced from pAAV CD68-hM4D(Gi)-mCherry (#75033). In addition to the viral particles, you will also receive purified pAAV CD68-hM4D(Gi)-mCherry plasmid DNA. CD68-driven hM4D(Gi) receptor with an mCherry reporter for CNO-induced microglial inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCD68TagsmCherryAvailable sinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
PCV-Cas9
Plasmid#123643PurposeExpresses Cas9 with an N-terminal HUH-tag called PCV2DepositorAvailable sinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
psPAX2-D64V-NC-MS2
Plasmid#122944PurposeMS2 coat protein-modified lentiviral packaging plasmid for packaging mRNA with an MS2 aptamer into lentivirus-like particlesDepositorInsertNC-MCP (MS2 coat protein) fusion protein in Gag
UseLentiviralExpressionMammalianMutationD64VAvailable sinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330 spCas9-mSA
Plasmid#113096PurposepX330 vector carrying spCas9-mSA for gene editing in mammalian cell linesDepositorInsertCAS9-MSA
UseSynthetic BiologyTagsMSA (monomeric streptavidinMutationnoneAvailable sinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX459V2.0-HypaCas9
Plasmid#108294PurposepX459 V2.0 (Plasmid #62988) with the N692A, M694A, Q695A, and H698A mutationsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable sinceJuly 20, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pB-CAGGS-dCas9-KRAB
Plasmid#110822PurposePiggyBac compatible plasmid expressing dCas9-KRABDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdCas9-KRAB
ExpressionMammalianMutationCas9 mutations to make dCas9=D10A+D839A+H840A+N86…PromoterCAGGSAvailable sinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3.1 Dendra2
Plasmid#103967PurposeMammalian expression of fluorescent protein Dendra2 used for transfection efficiency controlDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertDendra2
ExpressionMammalianAvailable sinceJuly 16, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pACYC-Taq
Plasmid#102793PurposeExpresses Taq DNA polymerase under WT T7 promoterDepositorInsertTaq DNA polymerase
ExpressionBacterialAvailable sinceJuly 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
Bassik lab Mouse CRISPR-Cas9 Deletion Library - Membrane proteins
Pooled library#1000000124PurposeCRISPR gRNA mouse knockout pooled library - Membrane proteinsDepositorAvailable sinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable sinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pACAGW-ChR2-Venus-AAV (AAV1)
Viral prep#20071-AAV1PurposeReady-to-use AAV1 particles produced from pACAGW-ChR2-Venus-AAV (#20071). In addition to the viral particles, you will also receive purified pACAGW-ChR2-Venus-AAV plasmid DNA. CAG-driven, channelrhodopsin fused to Venus for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPublicationPromoterCAGGTagsVenusAvailable sinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO ChETA-EYFP (AAV5)
Viral prep#26968-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-Ef1a-DIO ChETA-EYFP (#26968). In addition to the viral particles, you will also receive purified pAAV-Ef1a-DIO ChETA-EYFP plasmid DNA. EF1a-driven, Cre-dependent, ChETA fused to EYFP for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsEYFP (Cre-dependent)Available sinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAW63.YY1.FKBP.knock-in.BFP
Plasmid#104371PurposeFor knocking in FKBP F36V P2A BFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertFKBP12(F36V) -P2A-BFP
Available sinceDec. 21, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pWS158
Plasmid#90517PurposeCas9 gap repair vector - URA3DepositorInsertCas9
UseCRISPRExpressionYeastAvailable sinceOct. 19, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
DNA-PKcs T3950D
Plasmid#83320PurposeDNA-PKcs T3950ADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuman DNA-PKcs (PRKDC Human)
ExpressionMammalianMutationActivation loop phosphorylation site 3950 substit…Available sinceAug. 8, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSFV-Helper1
Plasmid#92073PurposeThis is a plasmid for transcription of defective helper RNA, providing structural Semliki forest virus (SFV) proteins to package recombinant SFV genomes into virus like particles.DepositorInsertcDNA of SFV genome with deletion removing the nonstructural SFV proteins and also the viral RNA packaging signal.
UseHelper plasmid, for run-off transcription and rna…Available sinceJuly 26, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pET-CjCas9
Plasmid#89754PurposeExpression of CjCas9 with His tag in E.coliDepositorInsertCjCas9
UseCRISPRTags6XHis, HA, and SV40 NLSExpressionBacterialPromoterT7Available sinceMay 25, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by