We narrowed to 8,392 results for: crispr grnas
-
Plasmid#75397PurposesgRNA1-boxB-MS2-PP7DepositorInsertsgRNA1-boxB-MS2-PP7
UseCRISPR and LentiviralTagsnoExpressionMammalianPromoterU6Available SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
gRNA_DNMT3a-T1
Plasmid#41821PurposeExpresses a guide RNA (gRNA) to target DNMT3a (T1 target sequence) for genome engineeringDepositorAvailable SinceJan. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
EGFP gRNA (BRDN0000561167)
Plasmid#80034Purpose3rd generation lentiviral gRNA plasmid targeting EGFPDepositorInsertEGFP
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330-LMNA-gRNA1
Plasmid#122507Purposeexpresses WT spCas9 and a chimeric gRNA targeting human LMNADepositorInsertLMNA-gRNA1
UseCRISPRExpressionMammalianPromoterU6Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgPBRM1-1- LentiCRISPRv2
Plasmid#107403PurposeLentiviral expression of Cas9 and gRNA targeting PBRM1DepositorInsertgRNA targeting PBRM1 (PBRM1 Human)
UseLentiviralAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDuRCC-N
Plasmid#81194PurposeExpression of Cas9 and two gRNA cassettes in S. cerevisiae; Nourseothricin ResistanceDepositorInsertsCas9
empty gRNA cassette
empty gRNA cassette
UseCRISPRTagsNTSExpressionYeastMutationPlease view depositor comments below and WT - cod…PromoterROX3 and SNP52pAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pC0051-W85X REPAIR targeting guide cloned into pC0043
Plasmid#103867PurposeGuide RNA expression plasmid for dPspCas13b that can be used to direct ADAR deaminase domain activity to the W85X mutation in the luciferase reporter plasmid pC0038DepositorInsertW85X targeting guide RNA
UseCRISPRExpressionMammalianAvailable SinceNov. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgp53/Cre
Plasmid#89646PurposeExpresses a p53-targeting gRNA and Cre-recombinaseDepositorAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgPBRM1-2- LentiCRISPRv2
Plasmid#107404PurposeLentiviral expression of Cas9 and gRNA targeting PBRM1DepositorInsertgRNA targeting PBRM1 (PBRM1 Human)
UseLentiviralAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
gRNA_DNMT3a-T2
Plasmid#41822PurposeExpresses a guide RNA (gRNA) to target DNMT3a (T2 target sequence) for genome engineeringDepositorAvailable SinceJan. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
Adeno EA
Plasmid#64071PurposeAdenovirus for the expression of gRNAs targeting intron 19 of murine Alk and intron 14 of Eml4DepositorInsertU6_sgRNA(Alk)_U6_sgRNA(Eml4)_CBh_FLAG-Cas9
UseAdenoviralTagsFLAG-Cas9PromoterU6 and CBhAvailable SinceJuly 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLH-sgRNA1-MS2-PP7
Plasmid#75392PurposesgRNA1-MS2-PP7DepositorInsertsgRNA1-2XMS2-PP7
UseCRISPR and LentiviralTagsnoExpressionMammalianPromoterU6Available SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRII-BbsI-sgRNAscaffold
Plasmid#159352PurposeExpression vector for a customizable guide RNADepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceNov. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
UAS-4x(tRNA::axed{sgRNA})
Plasmid#187883PurposeGal4/UAS sgRNA expression targeting axedDepositorInsert4 sgRNAs targeting axed
Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
UAS-4x(tRNA::hiw{sgRNA})
Plasmid#187884PurposeGal4/UAS sgRNA expression targeting hiwDepositorInsert4 sgRNAs targeting hiw
Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-DNMT3A-PuroR_hNT
Plasmid#71830PurposeExpression of dCas9-DNMT3A fusion with T2A-PuroR and non-targeting control sgRNA for use in human cellsDepositorInsertNon-targeting sgRNA human (DNMT3A Synthetic, Human, S. pyogenes)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-PuroRExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9PromoterU6Available SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgUFM1
Plasmid#86133PurposeLentiviral vector expressing Cas9 and an sgRNA targeting UFM1DepositorAvailable SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-TRAF6-targeting sgRNA 1
Plasmid#131345PurposegRNA targeting mouse TRAF6DepositorAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
M-SP-sgRNA
Plasmid#48671PurposeMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPRv2-sgEGFP
Plasmid#86153PurposeLentivirus carrying Cas9/CRISPR for cut in GFP (used as control)DepositorInsertEGFP
UseCRISPR and LentiviralAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only