We narrowed to 14,512 results for: SHR
-
Plasmid#119268Purposerfp "test" strainDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSEM376 - sgRNA - spc4 - array - insertion - unc-119 - locus
Plasmid#182344PurposesgRNA4 for insertion of extrachromosomal arrays into the ce-unc-119 genomic locus. Use with pSEM371 fragment included in Ex array.DepositorInsertSpacer 4
ExpressionWormAvailable SinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPRv2-sgEGFP
Plasmid#86153PurposeLentivirus carrying Cas9/CRISPR for cut in GFP (used as control)DepositorInsertEGFP
UseCRISPR and LentiviralAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-control-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128347PurposepAAV encoding control gRNA for CRISPR gRNAs listed aboveDepositorInsertcontrol (negative)
UseCRISPRExpressionMammalianAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1187
Plasmid#119256Purposerfp "test" strainDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCutamp
Plasmid#140632PurposePlasmid-curing in Escherichia coli by targeting the AmpR promoterDepositorInsertSpCas9_lambda-RED system, SacB, Rha induction system, sgRNA targeting AmpR promoter
UseCRISPRExpressionBacterialAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-Cj-sgRNA
Plasmid#89753PurposeU6 promoter driven expression of Cj-SgRNA cloned with BsmbIDepositorInsertCj-SgRNA
UseSgrna expression under u6 promoterPromoterU6Available SinceMay 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAVS1_Cas9-hGem_gRNA2
Plasmid#217659Purposeexpresses Cas9-hGem and guideRNA targeting the human AAVS1 safe harbour locusDepositorInsertsgRNA2 targeting the human AAVS1 safe harbour locus
UseCRISPRExpressionBacterial and MammalianPromoterU6Available SinceJuly 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
-
pCfB3045(gRNA XI-3)
Plasmid#73287PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XI-3DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
p5068 pGEX-6P-1 Brd4 full-length
Plasmid#14447DepositorAvailable SinceMarch 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-tomato-TSC2-sgRNA
Plasmid#196195PurposeEditing human TSC2 locusDepositorInsertTSC2 (TSC2 Human)
UseCRISPRAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMD19-PBBa_J23117-sgRNA-Spr
Plasmid#190793PurposeTemplate vector to amplify single sgRNAs or pieces for multiplexing arrays. Has flanking BsaI-sites.DepositorInsertsgRNA (dummy)
UseSynthetic BiologyExpressionBacterialPromoterBBa_J23117Available SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-PCNT
Plasmid#227284PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of PCNT for knock-in.DepositorAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
Pzac2.1 U6-Ezr sgRNA1, 2, 3_gfaABC1D mcherry SV40
Plasmid#179119PurposeExpresses Ezr sgRNAs under the U6 promoter and mcherry protein specifically in astrocytesDepositorInsertEzr sgRNA
UseAAVPromoterU6Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJMP1055
Plasmid#119242Purposeconstruction intermediateDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialAvailable SinceDec. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-hsf-1-sgRNA-A
Plasmid#177786PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hsf-1 promoter)DepositorInserthsf-1 (hsf-1 Nematode)
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
sg14x(MS2) MUC4.1
Plasmid#101153PurposegRNA with 14 MCP binding siteDepositorInsertMUC4 (MUC4 Human)
UseCRISPR and LentiviralAvailable SinceNov. 9, 2017AvailabilityAcademic Institutions and Nonprofits only