We narrowed to 7,126 results for: poly
-
Plasmid#203472PurposeExpresses PV 3C protease from a GAL10 promoter with a URA3 markerDepositorAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pCB’ CsoS2 ΔNTD
Plasmid#162705PurposeCarboxysome operon with truncated CsoS2 (deletion of amino acids 2-256), prk; Deletion of rubisco-binding N-terminus of CsoS2DepositorInsertpHnCB10 derived carboxysome operon, prk
ExpressionBacterialMutationDeletion of residues 2-256 of CsoS2, Y131DPromoterPLtet0-1 promoterAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRK5-HA-Ubiquitin-K63
Plasmid#17606PurposeMammalian expression of HA tagged ubiquitin with K63 only, other lysines mutated to argininesDepositorInsertUbiquitin C (UBC Human)
TagsHAExpressionMammalianMutationK63 only, other lysines mutated to arginines. Enh…Available SinceMarch 31, 2008AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 TAP DHX36
Plasmid#53547Purposemammalian expression of DHX36DepositorAvailable SinceJune 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRK5-HA-Ubiquitin-K48
Plasmid#17605PurposeMammalian expression of HA tagged ubiquitin with only K48, other lysines mutated to argininesDepositorInsertUbiquitin C (UBC Human)
TagsHAExpressionMammalianMutationK48 only, other lysines mutated to arginines. Enh…Available SinceMarch 31, 2008AvailabilityAcademic Institutions and Nonprofits only -
ZsGreen1-cMYC/pLVX-Puromycin
Plasmid#180278PurposePlasmid encoding human c-MYC for reporter assays. Polycistronic puromycin selectable lentiviral vector (unmodified, from TAKARA BIO).DepositorAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
GIPR-DuET
Plasmid#213252PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E-IRES-H2A-mCherry-SV40-pA (JDW 1256)
Plasmid#224532PurposeA Gateway compatible 3' entry clone containing an IRES H2A mCherry followed by a polyADepositorInsertIRES-H2A-mCherry-SV40pA
UseGateway CloningAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Endo-INPP5E
Plasmid#236005PurposeEndosome-targeted inositol polyphosphate 5 phosphatase (INPP5E); hydrolyzes 5-phosphate in PI(3,4,5)P3 and PI(4,5)P2.DepositorInsertEndo-INPP5E (INPP5E Synthetic, Human)
Tags2xFYVE (Fab1/YOTB/Vac1/EEA1 zinc-finger) and mChe…ExpressionMammalianPromoterCMVAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ratiometric FPX sensor for ERK kinase activity
Plasmid#60974PurposeFor imaging of ERK kinase activity using a single polypeptide RA-WW domain-ERK substrate-B protein and free GA-NES.DepositorInsertddRFP A-WW domain-ERK substrate-ddFP B
TagsERK substrate is before ddFP copy B, WW domain is…ExpressionMammalianPromoterCMVAvailable SinceJan. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHIV-EGFP.Flag-EZH2
Plasmid#220243PurposeExpresses wild-type EZH2 for knockout/rescue experiments in mammalian cells.DepositorAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLJM1 flag-cFLIP
Plasmid#211529PurposeExpresses flag-tagged cFLIP (CFLAR)DepositorAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E-WPRE-SV40-pA (JDW 922)
Plasmid#224545PurposeA Gateway compatible 3' entry clone containing a woodchuck herpes simplex virus regulatory element (WPRE) to stabilize mRNA upstream of an SV40 polyADepositorInsertWPRE-SV40-pA
UseGateway CloningAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
MOM603
Plasmid#133242Purposeexpresses full-length human KIF1A fused with mScarlet and StrepII tag in insect cellsDepositorInsertkif1a (KIF1A Human)
TagsStrepII tag and mScarletExpressionInsectPromoterpolyhedrin promoterAvailable SinceJan. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFB1.HMBP.PrS.MTF2
Plasmid#125169PurposeExpresses human MTF2 in insect cells, under a C3-cleavable (PreScission Protease) N-terminal hexahistidine-MBP tag.DepositorAvailable SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAc-C Med12His
Plasmid#49240Purposeexpresses human Med12 with His tag in insect cellsDepositorAvailable SinceNov. 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
HAP40 1-371
Plasmid#124060PurposeBaculovirus expression vector for HAP40 protein (aa 1-371) in insect cellsDepositorInsertHAP40 (F8A1 Human)
UseBaculovirus expressionTags6x His and TEV cleavage sitePromoterpolyhedrinAvailable SinceApril 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EFS-FLTID-GSQ-RBXN-P2A-BLAST
Plasmid#208041PurposeEnables constitutive expression of TurboID alone; RBXN represents a EcoR1-BsiW1-Xba1-Not1 polylinker; selection with blasticidinDepositorInsertTurboID
UseLentiviralPromoterEFSAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO/GFPZNF598-9P-9A
Plasmid#141192PurposeExpresses GFP-ZNF598 mutated in polyproline streches in mammalian cells, can be used to make inducible cell lineDepositorInsertZNF598 (ZNF598 Human)
TagsGFPExpressionMammalianMutationall 3 proline repeats are mutated to Alanine (9xP…PromoterCMVAvailable SinceJune 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only