We narrowed to 8,876 results for: sgrna
-
Plasmid#212706PurposePlasmid for transient expression of pspCas9(BB)-2A-Puro nuclease and sgRNA targetting the C terminal of Zfp143 locusDepositorInsertZFP143 C-terminal sgRNA (Zfp143 Mouse)
UseCRISPRAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-(sgRNA-T2)-Chimeric_BB-CBh-hSpCas9
Plasmid#223323PurposeHuman codon optimized Cas9 expressing plasmid that carries the sgRNA T2 from Mali et al., 2013 (10.1126/science.1232033).DepositorInsertSpCas9 and sgRNA-T2 (cas9 )
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterU6Available SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC130: pAAV.CMV-CasRx-VEGFA sgRNA
Plasmid#203443PurposePlasmid expressing active RfxCas13d with VEGFA mRNA targeting gRNADepositorInsertsU6-VEGFA sgRNA
RfxCas13d
UseAAVTagsHA and NLSExpressionMammalianPromoterCMV and U6Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pM149: pAAV.CMV-Cas13e-VEGFA sgRNA
Plasmid#203447PurposePlasmid expressing active Cas13e with VEGFA mRNA targeting gRNADepositorInsertsU6-VEGFA sgRNA
Cas13e
UseAAVTagsHA and NLSExpressionMammalianPromoterCMV and U6Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pM155: pAAV.CMV-Cas13e (GenScript CO)-NT sgRNA
Plasmid#203451PurposePlasmid expressing active and codon optimised Cas13e with non-targeting gRNADepositorInsertsU6-non targeting (NT) sgRNA
Cas13e
UseAAVTagsHA and NLSExpressionMammalianMutationCodon optimised using GenScript toolPromoterCMV and U6Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC368: pAAV.CMV-Cas13e-VEGFA sgRNA2
Plasmid#227800PurposePlasmid expressing active Cas13e with VEGFA mRNA targeting gRNA2DepositorAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC369: pAAV.CMV-Cas13e-VEGFA sgRNA3
Plasmid#227801PurposePlasmid expressing active Cas13e with VEGFA mRNA targeting gRNA3DepositorAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tnnt2-Cre-U6-Lmna-sgRNA
Plasmid#206178PurposeExpresses Cre recombinase specifically in cardiomyocytes and uses U6 promoter to express sgRNAs targeting murine Lmna exon 10DepositorInsertCre
UseAAVPromotercTnTAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-empty-GFP
Plasmid#221843Purposeempty vector to clone custom sgRNA into BsaI sites to express sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertEGFP
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterCAGCAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-DNM1L -GFP
Plasmid#221845PurposeTol2 transposon expressing sgRNA targeting chick DNM1L from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
DNM1L sgRNA-gTGTTTTCCGACCATCCTCTG
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterCAGC and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-MFN1-GFP
Plasmid#221846PurposeTol2 transposon expressing sgRNA targeting chick MFN1 from chick U6.3 promoter expresses GFP reporter from GAGC promoteDepositorInsertsEGFP
MFN1 sgRNA-GAGAAGAAGAGCGTCAAGGT
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterCAGC and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-Lig4
Plasmid#220494PurposeTo generate LIG4 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against LIG4 exon 3.DepositorAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF821-recipient_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211651PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertGuide RNA recipient vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF820-recipient_U6-sgRNA-EF1a-mCherry2
Plasmid#211647PurposeU6-sgRNA-EF1a-mCherry2DepositorInsertGuide RNA recipient vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmATM
Plasmid#208392PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ATM gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmMRE11
Plasmid#208384PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine MRE11 gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmZBP1#3
Plasmid#208389PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ZBP1#3 gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmMLKL
Plasmid#208391PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine MLKL gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 2 hU6 ACTB sgRNA
Plasmid#206270PurposeENTR Vector 2 for MultiSite Gateway assembly. Encodes hU6 hACTB sgRNADepositorInsertACTB sgRNA
UseCRISPR; Multimate/gateway entr 2ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-ZNF91-BFP
Plasmid#202823PurposeLentiviral vector modified to express two sgRNAs that delete exon 1 within the ZNF91 gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete exon 1 within ZNF91 gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA23-sgRNA vector-U6-sgTS2 (SpCas9)
Plasmid#199454PurposeU6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC)DepositorInsertTS2 sgRNA
UseCRISPRPromotermouse U6Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA(OXTR.2)-CMV-eGFP
Plasmid#194016PurposeExpresses a gRNA that targets OXTR coding sequence in multiple (rodent) species and eGFPDepositorInsertssgRNA(Oxtr.2)
eGFP
UseAAV and CRISPRExpressionMammalianPromotercmb and u6Available SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-AsCpf1-2A-GFP-U6-tdTomato-sgRNA
Plasmid#194724Purposebased on (CAGGS-AsCpf1-2A-GFP-U6-sgRNA-cloning vector, Addgene 159281), with guide RNA that target tdTomatoDepositorArticleInsertAsCpf1
UseCRISPRExpressionMammalianAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
RPS4X sgRNA-3 lentiCRISPR v2-Blast plasmid
Plasmid#192233Purposelentiviral vector expressing sgRNA-3 targeting eIF3 binding site of RPS4X 5'UTRDepositorInsertsgRNA-3 targeting eIF3 binding site of RPS4X 5'UTR (RPS4X Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS15A sgRNA-5 lentiCRISPR v2-Blast plasmid
Plasmid#192230Purposelentiviral vector expressing sgRNA-5 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-5 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS4X sgRNA-4 lentiCRISPR v2-Blast plasmid
Plasmid#192234Purposelentiviral vector expressing sgRNA-4 targeting eIF3 binding site of RPS4X 5'UTRDepositorInsertsgRNA-4 targeting eIF3 binding site of RPS4X 5'UTR (RPS4X Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS15A sgRNA-4 lentiCRISPR v2-Blast plasmid
Plasmid#192229Purposelentiviral vector expressing sgRNA-4 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-4 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459-Flag-Mcm2 targeting sgRNA
Plasmid#186937PurposeGenomic targeting of Flag tag at Mcm2 N-terminalDepositorAvailable SinceAug. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-RDH11
Plasmid#161924PurposeTo generate RDH11 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against RDH11 exon 2.DepositorInsertsgRNA targeting RDH11 exon 2
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
330-BFP-hCYP3A4-enhancer-R-sgRNA
Plasmid#176841PurposeTargeting human CYP3A4 proximal enhancer right boundary. sgRNA expressing cells could be FACS sorted by BFP expression.DepositorInsertHuman CYP3A4 proximal enhancer right boundary
ExpressionMammalianPromoterU6Available SinceNov. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
330-cherry-hCYP3A4-enhancer-L-sgRNA
Plasmid#176840PurposeTargeting human CYP3A4 proximal enhancer left boundary. sgRNA expressing cells could be FACS sorted by cherry expression.DepositorInsertHuman CYP3A4 proximal enhancer left boundary
ExpressionMammalianPromoterU6Available SinceNov. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330.puro sgRNA KGA Stop1
Plasmid#110405PurposeCRISPR/Cas9 vector with sgRNA for glutaminase KGA isoform C-Terminal Knock-in and puromycin resistanceDepositorAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNTI733 pRPR1(TetO)-RPC31-sgRNA
Plasmid#164913PurposeFor yeast genomic integration of sgRNA against RPC31DepositorInsertpRPR1(TetO)-RPC31-sgRNA
UseCRISPRExpressionYeastPromoterRPR1Available SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNTI732 pRPR1(TetO)-HTS1-sgRNA
Plasmid#164912PurposeFor yeast genomic integration of sgRNA against HTS1DepositorInsertpRPR1(TetO)-HTS1-sgRNA
UseCRISPRExpressionYeastPromoterRPR1Available SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 sgRNA sCRNA 2.0 (GB2461)
Plasmid#160593PurposeVersion of the native Cas9-sgRNA with one native WT aptamer sequence and F6 aptamer sequence recognized for Ms2 coat protein, in 3'.DepositorInsertsgRNA sCRNA 2.0
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-5U6-sgRNAs-hsyn-EGFP
Plasmid#112213PurposeTargeted DNA methylationDepositorInsertsgRNAs
UseAAVAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-BsmBI_cassette-St1Cas9-sgRNA (KAC14)
Plasmid#133791PurposeU6 promoter sgRNA entry vector used for all St1Cas9 sgRNAs (clone spacer oligos into BsmBI cassette) - similar to V1 sgRNA architecture from Carter et al. biorxiv 2018DepositorInsertSt1Cas9 sgRNA entry vector
ExpressionMammalianMutationV1 sgRNA architecture from Carter et al. biorxiv …PromoterU6Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-BsmBI_cassette-St3Cas9-sgRNA (KAC27)
Plasmid#133792PurposeU6 promoter sgRNA entry vector used for all St3Cas9 sgRNAs (clone spacer oligos into BsmBI cassette) - similar to sgRNA architecture from Muller et al. Molecular Therapy 2015DepositorInsertSt3Cas9 sgRNA entry vector
ExpressionMammalianMutationsgRNA architecture from Muller et al. Molecular T…PromoterU6Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Spa)_gcrA3
Plasmid#133343Purposefor constitutive expression of a single guide RNA from Streptococcus pasteurianus with a seed region that targets gcrA gene's promoter from Caulobacter crescentusDepositorInsertsgRNA_gcrA
UseCRISPRPromoterconstitutiveAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_blaA
Plasmid#133345Purposefor constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets blaA gene's promoter from Caulobacter crescentusDepositorInsertsgRNA_blaA
UseCRISPRPromoterconstitutiveAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only