We narrowed to 4,526 results for: GCA
-
Plasmid#162120PurposeLentiviral sgRNA plasmid targeting human AMPK alpha1DepositorInsertsgAMPK alpha1 (PRKAA1 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFA0055
Plasmid#131774PurposeGuide RNA (gCASS5a) and Cas9 expression plasmid for cleaving pFA6 series deletion cassettes, including KanMX, hphMX and natMX. Used to perform CRISPR-Swap of alleles.DepositorInsert20mer CASS5a guide (gCASS5a) and 5' sgRNA
UseTagsExpressionBacterial and YeastMutationPromoterAvailable sinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
ATP1A1_G8_Dual_sgRNA
Plasmid#178104PurposeCoselection for PE3 in human cells. Vector for tandem expression of ATP1A1 G8 sgRNA with a user-specified PE3 nick sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G8 sgRNA + user-specified sgRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ANAPC1 A2.3 gRNA
Plasmid#90529Purpose3rd generation lentiviral gRNA plasmid targeting human ANAPC1DepositorInsertANAPC1 (Guide Designation A2.3)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJG488
Plasmid#91196PurposeWDV replicon T-DNA for gene targeting in wheat scutella, H840A double nickase (nTaCas9_H840A+gUbi8+gUbi1+donor)DepositorInsertnTaCas9_H840A+gUbi8+gUbi1+donor
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQCascade-IS2
Plasmid#140625PurposeExpresses V. cholerae TniQ, Cas8, Cas7, and Cas6 and crRNA-IS2. The crRNA-IS2 targets IS2 loci in Escherchia coli.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, crRNA-IS2
UseCRISPR; TransposonTagsExpressionBacterialMutationPromoterAvailable sinceJuly 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAT15416-BEAR-mScarlet-target-BFP
Plasmid#162996Purposeplasmid expressing an sgRNA targeting the BEAR-mScarlet plasmid along with a TagBFP markerDepositorInsertsgRNA targeting the BEAR-mScarlet plasmid
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRA-31-murderous_crow
Plasmid#138985PurposeIVT template for the alpha subunit of the mouse TCR #31 that is reactive against MC38DepositorInsertTCRA (Tcra Mouse)
UseTagsExpressionMammalianMutationPromoterCMV and T7Available sinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRB-30-picky_sticky
Plasmid#138984PurposeIVT template for the beta subunit of the mouse TCR #30 that is reactive against MC38DepositorInsertTCRB (Tcrb Mouse)
UseTagsExpressionMammalianMutationPromoterCMV and T7Available sinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pB-puro-mU6-CNPshRNA1
Plasmid#126611PurposeExpresses shRNA against human CNP under mouse U6 promoterDepositorInsertCNP ShRNA-1 (CNP Human)
UseRNAiTagsExpressionMutationPromotermouse U6 promoterAvailable sinceJune 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL3-2
Plasmid#109010PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorInsertATL3-sgRNA #2 (ATL3 Human)
UseLentiviralTagsExpressionMammalianMutationPromotermU6 promoterAvailable sinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_RUNX1_Nick-38_Dual_sgRNA
Plasmid#173214PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and RUNX1 nick-38 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 sgRNA + RUNX1 Nick-38 sgRNA
UseCRISPR; Prime editing (pe3)TagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR sgHAL
Plasmid#102315Purposegenetic depletion of HALDepositorInsertsgHAL (HAL Human)
UseLentiviralTagsExpressionMutationPromoterU6Available sinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-shEsr1
Plasmid#120720PurposeLentiviral vector that expresses GFP and an shRNA targeting Esr1 (in pLL3.7).DepositorInsertEsr1 shRNA (Esr1 Mouse)
UseLentiviral and RNAiTagsGFPExpressionMammalianMutationPromoterMouse U6Available sinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
WPXL LEFTY2 gRNA
Plasmid#101924PurposeLEFTY2 gRNA used for targeted demethylation is inserted into the WPXL lentiviral backbone.DepositorInsertLEFTY2 enhancer targeting gRNA
UseLentiviralTagsExpressionMutationPromoterAvailable sinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRSET a sfMatryoshCaMP6s
Plasmid#100020PurposeBacterial expression of fluorescent reporter for calcium signaling, based off of GCaMP6s. Contains a stable reference Large Stokes Shift (LSS) mOrange nested within the reporting superfolder cpGFP.DepositorInsertsfMatryoshCaMP6s
UseTags6x HIS tag and Xpress_EK tagExpressionBacterialMutationcpEGFP replaced with superfolder cpGFPPromoterT7Available sinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
PPP2R5D B12.5 gRNA
Plasmid#90854Purpose3rd generation lentiviral gRNA plasmid targeting human PPP2R5DDepositorInsertPPP2R5D (Guide Designation B12.5)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAS19
Plasmid#158788PurposeRibosome-tagged GCaMP (soma localized) expression in C. elegans ASH neuronsDepositorInsertpsra-6::GCaMP6m::rpl-1a
UseTagsExpressionWormMutationPromoterAvailable sinceSept. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAS16
Plasmid#158786PurposeRibosome-tagged GCaMP (soma localized) expression in C. elegans AFD neurons (and others)DepositorInsertPntc-1::GCaMP6m::rpl-1a
UseTagsExpressionWormMutationPromoterAvailable sinceSept. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX458_KLF9_2
Plasmid#86347PurposeEncodes gRNA for 3' target of human KLF9DepositorInsertgRNA against KLF9 (KLF9 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
BUB3 A10.1 gRNA
Plasmid#90557Purpose3rd generation lentiviral gRNA plasmid targeting human BUB3DepositorInsertBUB3 (Guide Designation A10.1)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJuly 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorInsertd5-HT2BR gRNA2 (CG42796 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459_LIG4_Exon3
Plasmid#225363PurposepX459 plasmid encoding the sgRNA protospacer sequence “5’-GCATAATGTCACTACAGATC-3’ to target the LIG4 gene.DepositorInsertLIG4 (LIG4 Human)
UseCRISPRTagsExpressionMutationPromoterU6Available sinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-3mer-35kb-DSF
Plasmid#227492Purpose3-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
VirTREX2-HLDel-1_NbATML1-1pro
Plasmid#231149PurposeT-DNA encoding TRV2 with TREX2 and mobile gRNA targeting NbATML1-1proDepositorInsertTREX2 and mobile gRNA targeting NbATML1-1pro
UseTagsExpressionPlantMutationPromoterPEBV sub-genomicAvailable sinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgMTHFD1
Plasmid#217436PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human MTHFD1DepositorInsertsgRNA targeting MTHFD1 (MTHFD1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDY2259 hNOLC1 atgRNA Paired Guide 1
Plasmid#220989PurposehNOLC1 atgRNADepositorInsertNOLC1 atgRNA (NOLC1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY2260 hNOLC1 atgRNA Paired Guide 2
Plasmid#220990PurposehNOLC1 atgRNADepositorInsertNOLC1 atgRNA (NOLC1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY2262 hACTB atgRNA Paired Guide 2
Plasmid#220992PurposehACTB atgRNADepositorInsertACTB atgRNA (ACTB Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nucGFP11-3xPax7gRNA
Plasmid#224570PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)ExpressionMutationCodon optimizedPromoterAvailable sinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-3xGFP11-mem-3xPax7gRNA
Plasmid#224571PurposeUbiquitous expression plasmid with CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage, three membrane split GFP(11) reporter.DepositorInsert3xGFP11
UseCRISPRTagsMembrane Localization SignalExpressionMutationCodon optimizedPromoterAvailable sinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-hL1-gRNA1-EGFP
Plasmid#226002PurposeCRISPRi-KD of human LINE1DepositorInsertsgRNA targeting human L1HS
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-hL1-gRNA2-EGFP
Plasmid#226003PurposeCRISPRi-KD of human LINE1DepositorInsertsgRNA targeting human L1HS
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
eGFP-SUN1ΔN
Plasmid#213508PurposeExpresses human eGFP-SUNΔN in mammalian cellsDepositorInserteGFP-SUNΔN
UseTagsExpressionMammalianMutationSUN1ΔN has the first 138 amino acid (lamina domai…PromoterCMVAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Teton-puro-shPP1C #2
Plasmid#198763Purposeconditional knockdown of PP1CDepositorInsertshPP1C #2 (PPP1CC Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only