We narrowed to 58,632 results for: CaS;
-
Plasmid#158713PurposeCRISPR-assisted-NHEJ system used for genome editing in Mycobacterium smegmatis, expresses FnCpf1, NHEJ machinery of M. marinumDepositorInsertthe MmNHEJ machinery (MMAR_4573, MMAR_4574, and MMAR_4575)
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMSP3545-dCas9Str
Plasmid#153516PurposeExpresses dCas9str under nisin-inducible nisA promoter in pMSP3545 backboneDepositorInsertdCas9Str
UseTagsExpressionBacterialMutationPromoternisAAvailable sinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
LIC1B_Caspase-LOVN7C-7
Plasmid#104629Purposebacterial expression of light-activated caspase-3 with N7C-7 linker variationDepositorInsertCaspase-3 (CASP3 Human)
UseTagsHis and LOV2ExpressionBacterialMutationPromoterT7Available sinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
All_in_one_CRISPR/Cas9_LacZ
Plasmid#74293Purpose"All-in-one" CRISPR/Cas9 (wt) plasmid for cloning of custom gRNA with blue/white screeningDepositorInsertsLacZ-alpha
Cas9
mCherry
UseCRISPRTagsHAExpressionBacterial and MammalianMutationPromoterLac promoter, SV40, and T7 promoterAvailable sinceMay 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-J23111
Plasmid#113149PurposePlasmid constitutively expressing dCas9 proteinDepositorInsertdCas9
UseTagsExpressionBacterialMutationD10A & H840APromoterAvailable sinceJan. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a-KRAB_crRNA NC
Plasmid#176262PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged to the KRAB domain and Nlux and spacer sequence is replaced by the type IIS restriction site for endonucleasDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsKruppel associated box domain and luciferaseExpressionMutationD917A and E1006A mutations to inactivate the endo…PromoterAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
p201B Cas9
Plasmid#59177PurposeCas9 driven by double 35S, BAR for plant selection, I-PpoI site to accept gRNA from pUC gRNA ShuttleDepositorInsertsCas9
BAR
UseCRISPRTagsExpressionMutationPromoter2x35SAvailable sinceSept. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJL1-SpCas9
Plasmid#117051PurposeIn vitro expression of S. pyogenes Cas9 from the T7 promoterDepositorInsertS. pyogenes Cas9
UseTagsExpressionBacterialMutationPromoterT7Available sinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
dCas9-ddMSK1
Plasmid#165603PurposeExpresses Sp dCas9 fused to truncated inactive human MSK1 (42-802, D195A, D565A)DepositorInsertS. Pyogenes dCas9 with c-terminal truncated inactive human Mitogen- and stress-activated protein kinase-1 (42-802, D195A, D565A) (RPS6KA5 Human, S. Pyogenes, Synthetic)
UseCRISPR and LentiviralTagsFLAG TagExpressionMammalianMutationPromoterEF1aAvailable sinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
Cas9-GFP_sg_mAMPKa1
Plasmid#79004PurposeExpresses WT Cas9 and GFP, along with a sgRNA to mouse AMPK alpha 1.DepositorInsertPrkaa1 (Prkaa1 Mouse)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
dCas9-MSK1
Plasmid#165601PurposeExpresses Sp dCas9 fused to human MSK1DepositorInsertribosomal protein S6 kinase A5 (RPS6KA5 Human, S. Pyogenes, Synthetic)
UseCRISPR and LentiviralTagsFLAG TagExpressionMammalianMutationPromoterEF1aAvailable sinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
SauKKHCas9 PE2*
Plasmid#169852PurposeMammalian Expression, sauCas9-KKH based prime editorDepositorInsertSaCas9KKH-N580A-M-MLV
UseTagsbpSV40 NLS and SV40 NLS and cmyc-NLS and bpSV40 N…ExpressionMammalianMutationPromotercmvAvailable sinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
BB3cK_pGAP_23*_pLAT1_Cas9
Plasmid#104908PurposehCas9 under control of LAT1 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on G418DepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
p276 eSpCas9_2gRNAs_hH11
Plasmid#164850PurposegRNA vector for targeting human H11 locusDepositorInsertgRNAs for targeting human H11 locus
UseTagsExpressionMammalianMutationPromoterU6Available sinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pScI_dCas9-CDA
Plasmid#108549PurposeBacterial Target-AID vectorDepositorInsertdCas9-PmCDA1
UseTagsFlagExpressionBacterialMutationD10A and H840A for SpCas9Promoterlambda ORAvailable sinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
xCas9 3.6
Plasmid#108384PurposeMammalian expression vector for xCas9 3.6DepositorInsertxCas9 3.6
UseTagsNLSExpressionMammalianMutationE108G, S217A, A262T, S409I, E480K, E543D, M694I, …PromoterAvailable sinceMarch 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti_dCas9-2xAM
Plasmid#92220PurposeLentiviral plasmid expressing dCas9-2xAM and gRNA cloned in Bbs I sitesDepositorInsertsSp-dCas9-2xAM tag
gRNA to be inserted into Bbs I sites
UseCRISPR and LentiviralTags2xAM tagExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterCBh and U6Available sinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
SaCas9v2-Puro
Plasmid#178802PurposeSaCas9 with 2A-Puro, and a cloning backbone for sgRNA.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available sinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only