We narrowed to 13,278 results for: ache
-
Plasmid#162107PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to VSVg-HA-AU1
UseLentiviralTagsVSVg-HA-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-VSVg-FLAG-AU1
Plasmid#162108PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to VSVg-FLAG-AU1
UseLentiviralTagsVSVg-FLAG-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-StrepTagII-HA-FLAG
Plasmid#162112PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to StrepTagII-HA-FLAG
UseLentiviralTagsStrepTagII-HA-FLAGMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-VSVg-ProtC-FLAG
Plasmid#162084PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to VSVg-ProtC-FLAG
UseLentiviralTagsVSVg-ProtC-FLAGMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-StrepTagII-ProtC-HA
Plasmid#162089PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to StrepTagII-ProtC-HA
UseLentiviralTagsStrepTagII-ProtC-HAMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-StrepTagII-ProtC-AU1
Plasmid#162091PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to StrepTagII-ProtC-AU1
UseLentiviralTagsStrepTagII-ProtC-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-VSVg-StrepTagII-HA
Plasmid#162080PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to VSVg-StrepTagII-HA
UseLentiviralTagsVSVg-StrepTagII-HAMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX_305-N-dTAG_OGT
Plasmid#155196PurposeN-terminal FKBP12(F36V)-2xHA tag on lentiviral OGT constructDepositorInsertO-GlcNAc Transferase (OGT Human)
UseLentiviralTags2x HA and FKBP12(F36V)ExpressionMammalianMutationlacking N-terminal MetAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-CMV-mTagBFP2-2A-FLAG-ntcGAS
Plasmid#102603PurposeLentivector to express Flag-tagged and shRNA-resistant cGAS and mTagBFPDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNL-CEF-IgG1-IRES-GFP
Plasmid#187008PurposeExpression of human anti-SARS-CoV-2 S Protein Wuhan-Hu1 IgG1DepositorInsertHuman anti-SARS-CoV-2 S Protein Wuhan-Hu1 IgG1
UseLentiviralAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
ASC-CASP1 Octamer
Plasmid#164032PurposeBacterial expression vector encoding a 5GSS-linked ASC(CARD)-CASP1(CARD) construct to express an octamerDepositorTagsHis6-MBP-TEVExpressionBacterialMutationW169G (ASC), G20K (CASP1)Available SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
NES-EGFP-cPHx2
Plasmid#116854PurposePI(3,4)P2 biosensorDepositorInsertPLEKHA1 (PLEKHA1 Human)
TagsEGFP and X.leavis map2k1.L(32-44)ExpressionMammalianMutationamino acids 169-329 (tandem dimer)Available SinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28a-TEV-U1AF37MF77M
Plasmid#168267PurposeExpresses human dmU1A with the F37M/F77M double mutantDepositorInsertU1A RRM1 crystallization module (SNRPA Human)
Tags6xHis tag N-terminus, TEV protease cleavage siteExpressionBacterialMutationchanged F37M and F77MPromoterT7 promotorAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
shBIRC5 # 2
Plasmid#42554DepositorAvailable SinceFeb. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap-FLEX.SF-iGluSnFR.A184V
Plasmid#106181PurposeMedium affinity glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorHas ServiceAAV1InsertSF-iGluSnFR.A184V
UseAAVMutationGltI: A184VPromoterhSynapsinAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-sTagRFP-TUBA1B
Plasmid#207769PurposeDonor template for Puro-2A-sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Puro-sTagRFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
shBIRC5 # 1
Plasmid#42553DepositorAvailable SinceFeb. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-3xVenusYFP-OcsT
Plasmid#71271PurposeEntry clone containing three repeats of Venus. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsert3 times VenusYFP
UseGatewayTagsoctaline synthase terminatorAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
Rab8-T22N(Flag) in pcDNA3.1neo
Plasmid#46784Purposeexpression of T22N Rab8a in mammalian cellsDepositorInsertRAB8A T22N (RAB8A Human)
TagsFLAGExpressionMammalianMutationT22N dominant negativePromoterCMVAvailable SinceNov. 14, 2013AvailabilityAcademic Institutions and Nonprofits only