We narrowed to 26,832 results for: GFP
-
Plasmid#58805PurposeAAV expression of Chronos-GFP under the CaMKII promoterDepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterCaMKIIAvailable SinceAug. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
lenti-25xUPRE-minP-EGFP
Plasmid#159668PurposeEGFP reporter plasmid containing 25 tandem repeats of the the unfolded protein response element (UPRE)DepositorInsert25xUPRE-minP-EGFP
UseLentiviralExpressionMammalianAvailable SinceMarch 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSCALPs-HA-NFAT1 (4-460)-GFP
Plasmid#88879PurposeLentiviral vector expressing the fusion protein HA-NFAT1 (4-460)-GFPDepositorInsertHA-NFAT1 (4-460)-GFP fusion protein (Nfatc2 Mouse)
UseLentiviralTagsGFP fusion protein and HA tagExpressionMammalianMutationamino acids 4-460 only; L78P & L287P *see bel…PromoterSFFV (spleen focus forming virus)Available SinceMay 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
lenti-25xERSE2-minP-EGFP
Plasmid#159667PurposeEGFP reporter plasmid containing 25 tandem repeats of the ER stress response element-2 (ERSE2)DepositorInsert25xERSE2-minP-EGFP
UseLentiviralExpressionMammalianAvailable SinceMarch 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-GFP-LC3-RFP
Plasmid#84573PurposeExpresses GFP-LC3-RFP in mammalian cells to measure autophagic fluxDepositorInsertmicrotubule-associated protein 1 light chain 3 beta (Map1lc3b Rat)
UseRetroviralTagsEGFP and mRFP1ExpressionMammalianAvailable SinceJan. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-EGFP-RhoA-Q63L
Plasmid#12968DepositorInsertRhoA constitutively active (RHOA Human)
TagsEGFPExpressionMammalianMutationQ63L Constitutively activeAvailable SinceOct. 27, 2006AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide Puro-P2A-EGFP
Plasmid#137729PurposeFor simple determination of the multiplicity of infection (MOI) of a lentiviral CRISPR library by checking EGFP expression (still allowing for puro selection).DepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyTagsEGFPExpressionBacterial and MammalianAvailable SinceFeb. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
mini-donor - NKX6.1-nEGFP
Plasmid#206047Purposethis mini-donor knockin vector can be used to knock nuclear EGFP into NKX6.1 locusDepositorInsertnuclear EGFP
Available SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLJC5-3XHA-EGFP-PEX26
Plasmid#139054PurposeHA-PEROXO Lentiviral Construct. Expresses a Peroxisomal Tag.DepositorInsert3XHA-EGFP-PEX26
UseLentiviralTagsHAPromoterUBCAvailable SinceMarch 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 CMV Cyclone-EGFP
Plasmid#247495PurposeAcyclovir-regulated EGFPDepositorInsertEGFP gene with Cyclone insertion
UseSynthetic BiologyExpressionMammalianMutationCyclone was inserted after Glutamine94 of EGFP to…PromoterCMVAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lentiviral-TOP-dGFP-reporter
Plasmid#14715PurposeBeta-catenin reporter - 3rd generation self-inactivating lentiviral plasmid LEF-1/TCF-responsive promoter driven d2-eGFP (destabilized, half-life of 2h).DepositorAvailable SinceAug. 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLenti Lifeact-EGFP BlastR
Plasmid#84383PurposeLentiviral expression of EGFP-tagged Lifeact with Blasticidin selection in cells including neuronsDepositorInsertLifeact
UseLentiviralTagsEGFPPromoterCMV immediate earlyAvailable SinceJan. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP_mNG2(11)_Clathrin light chain
Plasmid#82608PurposeExpresses mNG2(11) tagged clathrin light chain in mammalian cellsDepositorInsertmNG2(11)_Clathrin light chain
ExpressionMammalianAvailable SinceMay 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVX neo PFKP-GFP
Plasmid#116940PurposeExpression of PFKP-GFP fusion proteinDepositorAvailable SinceFeb. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRRL SFFV d20GFP.T2A.mTagBFP Donor
Plasmid#31485DepositorInsertSFFV d20BFP T2A BFP
UseLentiviralMutationGFP has 20 amino acids deleted from the C terminu…Available SinceAug. 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
N8his-GFPenhancer-GGGGS4-LaG16
Plasmid#140442PurposeWe designed a flexible linker to connect two types of anti GFP nanobodies and used this fusion nanobody to purify GFP tagged protein.DepositorInsertGFPenhancer-GGGGS4-LaG16
Tags8 histidine tagExpressionBacterialPromoterT7 promotorAvailable SinceMay 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-FLAG-GFP-Tmem192
Plasmid#134630Purposelysosomal markerDepositorAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-Bi-gePSI-pCMV-AcGFP
Plasmid#131008PurposeExpresses both the gePSI-α-chain and the gePSI-β-chain under control of the inducible bi-directional TRE3G promoter. Expresses constitutively AcGFP under control of a CMV promoter.DepositorInsertsgePSI-β-chain
gePSI-α-chain
AcGFP1
UseAAVTagsmurine ornithine decarboxylase - degron (ODC36)ExpressionMammalianPromoterpCMV and pTRE3G-BiAvailable SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Pur-CAG-EGFP
Plasmid#80945Purposehuman AAVS1 site targeting donor plasmid for knocking-in EGFP expression cassette driven by CAG promoterDepositorInsertEGFP
ExpressionMammalianPromoterCAG promoterAvailable SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only