We narrowed to 10,399 results for: ADA
-
Plasmid#173787PurposeMammalian expression of SARS-CoV-2 Spike protein South African variant version 3DepositorInsertSpike (S-GSAS-B.1.351 variant version 3) (S Severe acute respiratory syndrome coronavirus 2)
TagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceAug. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-B.1.351
Plasmid#171749PurposeMammalian expression of SARS-CoV-2 Spike protein S-GSAS-D614G-B.1.351 variant (South African)DepositorInsertSpike (S-GSAS-B.1.351 variant) (S Severe acute respiratory syndrome coronavirus 2)
TagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceJuly 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-D614G-K417N-E484K-N501Y
Plasmid#171750PurposeMammalian expression of SARS-CoV-2 Spike protein S-GSAS-D614G-K417N-E484K-N501YDepositorInsertSpike (S-GSAS-D614G-K417N-E484K-N501Y variant) (S Severe acute respiratory syndrome coronavirus 2)
TagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceJuly 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-D614G-deltaFV
Plasmid#171743PurposeMammalian expression of SARS-CoV-2 Spike protein mink variant (S-GSAS-D614G-deltaFV variant)DepositorInsertSpike (S-GSAS-D614G-deltaFV variant) (S Severe acute respiratory syndrome coronavirus 2)
TagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceJuly 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-LYK5
Plasmid#23633DepositorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
rTTA-gRNA-AAV
Plasmid#213036PurposeThis vector contains rTTA expressed under CMV promoter and gRNA expressed under U6 promoterDepositorInsertrTTA-T2A-mCherry
UseAAV and CRISPRPromoterCMVAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-GFP-LA
Plasmid#206197PurposeExpresses GFP-tagged human Lamin-A protein by the constitutive CMV promoter in miceDepositorAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-FnCas9ABEmax8.17d
Plasmid#201955PurposeMammalian expression plasmid of FnCas9ABEmax8.17d base editor with T2A-EGFP and cloning backbone for sgRNADepositorInsertbpNLS-FnCas9ABEmax8.17d-bpNLS-3xHA-T2A-EGFP
UseCRISPRTags3xHA, NLS, and T2A-EGFPExpressionMammalianMutationD11A on FnCas9, V82S, V106W, Q154R on mutant TadAPromoterCbhAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-B.1.351.v4
Plasmid#173788PurposeMammalian expression of SARS-CoV-2 Spike protein South African variant version 4DepositorInsertSpike (S-GSAS-B.1.351 variant version 4) (S Severe acute respiratory syndrome coronavirus 2)
TagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceJan. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
B9-COMP-blac-flag-his
Plasmid#111020PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsert6-cysteine protein (B9) (PF3D7_0317100 )
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_1350600-COMP-blac-flag-his
Plasmid#110968PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertPF3D7_1350600 (PF3D7_1350600 )
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
GPR180-COMP-blac-flag-his
Plasmid#110955PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertPF3D7_1213500 (PF3D7_1213500 )
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBSWHhc-Lam
Plasmid#133902PurposeNegative control when used in combination with pAWH-largeT. Expression of Gal4BD-Bait hybrid protein. Homology regions for recombination with pAWHDepositorAvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9-NRRH-P2A-EGFP (RMD51)
Plasmid#197502PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with nSpCas9-NRRH(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e-nSpCas9-NRRH-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA and nSpCas9-NRRH(D10A/I32…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpRY-HF1-P2A-EGFP (LM434)
Plasmid#197507PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with nSpRY-HF1(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e-nSpRY-HF1-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA and nSpRY-HF1(D10A/A61R/N…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpRY-HiFi-P2A-EGFP (LM458)
Plasmid#197508PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with nSpRY-HiFi(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e-nSpRY-HiFi-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA and nSpRY-HiFi(D10A/A61R/…PromoterCMV and T7Available SinceMarch 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9-NRTH-P2A-EGFP (RMD21)
Plasmid#197503PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with nSpCas9-NRTH(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e-nSpCas9-NRTH-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA and nSpCas9-NRTH(D10A/I32…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNQL004-SOX2-FKBPV-HA2-P2A-mCherry targeting construct
Plasmid#175552PurposeTargeting vector to introduce an FKBPV-HA2-P2A-mCherry cassette at the mouse SOX2 locus. Degradation Tag (dTAG) system.DepositorInsertSOX2 (Sox2 Mouse)
UseMouse TargetingTagsFKBPV-HA2-P2A-mCherryExpressionMammalianMutationnoneAvailable SinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8.20m-SpCas9-NRCH-P2A-EGFP (RMD55)
Plasmid#197501PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE(8.20) A-to-G base editor with nSpCas9-NRCH(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8.20m-nSpCas9-NRCH-BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8.20 mutations in TadA and nSpCas9-NRCH(D10A/I…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only