We narrowed to 16,688 results for: GRN
-
Plasmid#176662PurposeExpression of sgRNA under Ae. albopictus U6 (AALF029743) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only
-
FgH1tUTG_mup53_Ex4
Plasmid#85534PurposeInducible expression of guide RNA (mup53_Ex4) with fluorescent GFP reporterDepositorInsertmu p53
PromoterH1tAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJRH056
Plasmid#171637PurposePlasmid containing a U6 promoter expressing a spyCas9 tdTom sgRNA298 and CAG promoter expressing mTagBFP2DepositorInsertsspyCas9 sgRNA-tdTomato
mTagBFP2
UseCRISPR and LentiviralExpressionMammalianPromoterCAG and U6Available SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
PE_CO-Mini-C
Plasmid#190337PurposeExpressing the C-terminal of PE_CO-Mini using Rma intein and Cas9 673-674 split site, and pegRNA for PCSK9 +1A insertionDepositorInsertPE_CO-Mini-C, PCSK9 +1A insertion pegRNA
UseAAVAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Consensus
Plasmid#176664PurposeExpression of sgRNA under mosquito consensus U6 promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
THI VP64 pALD4 T-
Plasmid#161481PurposeNon targeting control for CRISPR/RNA scaffold based transcription regulation in Pichia pastoris BB3rN_pTEF2_dCAS9(3xFLAG_SV40NLS)_pPOR1_MS2bind_only_SV40NLS_pALD4_THi11_T-_gRNA_MS2DepositorInsertsdCAS9
MS2-VP64
gRNA (Non targeting control NTC)
ExpressionYeastPromoterpALD4, pPOR1, and pTEF2Available SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B3
Plasmid#172844PurposeCRISPIE donor B3 (Zhong et al, eLife 2021), mTurquoise2 translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-0) encoding mTurquoise2
UseCRISPRAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Aaeg_774
Plasmid#176659PurposeExpression of sgRNA under Ae. Aegypti U6 (AAEL017774) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B4
Plasmid#172845PurposeCRISPIE donor B4 (Zhong et al, eLife 2021), mNeonGreen translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-0) encoding mNeonGreen
UseCRISPRAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAT-9218
Plasmid#124225PurposeBacterial SpCas9 expressionDepositorInsertSpCas9
UseCRISPRExpressionBacterialPromoterTetR/TetAAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B2615
Plasmid#91078PurposeModule B, Promoter: AtU6, Gene: BsaI ccdb cassette for single gRNA spacer cloning, Terminator: Pol IIIDepositorInsertBsaI ccdb cassette for single gRNA spacer cloning
UseCRISPRPromoterAtU6Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBLO2 casX
Plasmid#123122PurposeE. coli expression vector for CasX sgRNADepositorInsertCasX guide RNA
UseCRISPRAvailable SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK0_003
Plasmid#123925PurposeEncodes the spCas9 cassette and spCas9 gRNA GFP dropout expression cassette final destination vector as a type 0 part to be used in the MTK systemDepositorInsertCas9-sgRNA destination
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUD628
Plasmid#103018Purposeexpression of a Cpf1 programming crRNA targetting ADE2 (crADE2-3.S)DepositorAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-mGreenLantern/EGFP
Plasmid#179913PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting mGreenLantern and EGFP fluorescent proteins.DepositorInsertmGreenLantern/EGFP sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-FLAG-SpCas9-HF1
Plasmid#126770PurposeExpression of increased fidelity SpCas9-HF1 in bacterial cellsDepositorInsertSpCas9-HF1
UseCRISPRTags3xFLAG, 6xHis, MBP, and NLSExpressionBacterialMutationN497A, R661A, Q695A, Q926APromoterT7Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
GEARBOCS-SPARCL1-C-mCherryTag
Plasmid#218183PurposeTo tag Hevin with mCherry at its C-terminalDepositorInsertsgRNA (Sparcl1 Mouse)
UseAAV and CRISPRAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
p944-SWITCH-OVER insert: EF1a-Puro
Plasmid#217891Purposeinsert vector for Switch-OVER: Single loxP-STOP-EF1a-Puro-mU6DepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and LentiviralExpressionMammalianPromoterhU6Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4B-Agam_695
Plasmid#176668PurposeExpression of sgRNA under An. gambiae U6-2 (AGAP013695) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only