We narrowed to 16,419 results for: GRN
-
Plasmid#137177PurposeAAV genome: expresses the N-terminal of v5 AAV-ABE from the Cbh promoterDepositorInsertv5 AAV-ABE N-terminal
UseAAVMutationCas9 D10APromoterCbhAvailable SinceJan. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
v3em-Cterm-PE2max-∆RNaseH-dualU6
Plasmid#198735PurposeAAV genome encoding C-terminal PE2max and U6 expression cassettesDepositorInsertNpuC-CtermPE2max∆RNaseH
UseAAVPromoterCbhAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-tdTomato-P2A-BlasR (LRT2B)
Plasmid#110854PurposeLentiviral vector for constitutive expression of sgRNAs; includes tdTomato and BlasticidinS resistance markersDepositorInsertsgRNA scaffold with spacer
UseLentiviralMutationWTPromoterU6Available SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLQ14901
Plasmid#239276PurposeExpresses gG1 for pertubing endogenous human GAPDH mRNA via CRISPR-TODepositorAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV-EF1aGFP2AKAT7(E508Q)-W
Plasmid#159293PurposeLentiviral vector expressing GFP and KAT7 (gRNA-resistant, E508Q mutant) driven by human EF1a promoterDepositorInsertKAT7 E508Q
UseLentiviralExpressionMammalianMutationCRISPR sites mutated (gRNA ID. 5 and A10) and E50…Promoterhuman EF1a promoterAvailable SinceDec. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDicAID_nCas9-PmCDA_NptII_Della
Plasmid#91694PurposeDicot Target-AID vector expressing dicot-optimized nCas9-PmCDA1 with sgRNA targeting SlDellaDepositorInsertSpCas9
TagsPmCDA1ExpressionPlantMutationD10A for nickase Cas9PromoterPcUbiAvailable SinceJune 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLQ14902
Plasmid#239277PurposeExpresses gG2 for pertubing endogenous human GAPDH mRNA via CRISPR-TODepositorAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-EGFP
Plasmid#188900PurposeHuman lentiviral vector for expression of EGFP from a SFFV promoter with an upstream ubiquitous chromatin opening elementDepositorInsertEGFP
UseLentiviralPromoterSFFVAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV_NLS-dSaCas9-NLS-VPR
Plasmid#68495PurposeAAV vector containing nuclease null SaCas9 fused to VPRDepositorInsertdSaCas9
UseAAVTagsVPRExpressionMammalianPromoterCMVAvailable SinceSept. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-CMV-intron-CasRx-pA
Plasmid#192485PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Tubb3-GFP KI
Plasmid#131497PurposeEndogenous tagging of β3 Tubulin: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKRG3-mU6-PUb-3xFLAG-hSpCas9
Plasmid#162161PurposeExpresses 3xFLAG tagged hSpCas9 (Ae. aegypti PUb promoter) with cloning site for sgRNAs (Ae. aegypti U6 promoter)DepositorInsertshSpCas9
sgRNA
UseCRISPRTags3xFLAGExpressionInsectPromoterAe. aegypti PUb and Ae. aegypti U6Available SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR(RfxCas13d)-CAG-CasRx-pa
Plasmid#233035PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged CasRx from a CAG promoterDepositorInsertRfxCas13d-compatible gRNA expression cassette and CasRx
UseAAVAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-EFS-CasRx-T2A-mCherry-pA
Plasmid#192481PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoterU6/EFSAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSECC
Plasmid#60820Purpose3rd generation vector. Expresses a sgRNA of interest, Cas9 and CreDepositorInsertsCas9
Cre
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingTagsFlagExpressionMammalianMutationBsmBI site eliminated by C->A; E308GPromoterEFS and EFS (after Cas9-2A)Available SinceNov. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mCsnk2b - 1
Plasmid#198505Purposelentiviral stable expression of mCsnk2b gRNA 1DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHSN401
Plasmid#50588PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInserts3×FLAG-NLS-zCas9-NLS
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSMutationmaize codon optimizedPromoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9_sgAAVS1
Plasmid#199213PurposeAll-in-one plasmid encoding eSpCas9 and sgRNA targeting the AAVS1 site in human cells.DepositorInsertAAVS1-gRNA
UseCRISPRPromoterhuman U6Available SinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBUN411
Plasmid#50581PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInserts3×FLAG-NLS-zCas9-NLS
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSMutationmaize codon optimizedPromoterOsU3p and Ubi1pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only