We narrowed to 168,707 results for: addgene
-
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only
-
mLama1 AAV sgRNA 1, 2, 5
Plasmid#135339PurposeExpression plasmid of VP64-SadCas9 sgRNA 1, 2 and 3DepositorInsertLama1 VP64-dCas9 sgRNA Guides
UseAAVTagsEGFPExpressionMammalianPromoterCMVAvailable SinceMarch 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
6xHsa.NFKB:d2mRFP1
Plasmid#239991PurposeDestabilized red fluorescent protein (d2mRFP1) under transcriptional control of NF-kB activationDepositorInsertsmRFP1
PEST
Promotercfos minimal promoterAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMEL12
Plasmid#107918Purposehph based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-UPP1_sgRNA1
Plasmid#201634PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertUPP1 (UPP1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pROS10
Plasmid#107924PurposeURA3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX458-DsRed2
Plasmid#112219PurposeCloning backbone for sgRNA, co-expresses human optimized S. pyogenes Cas9 and DsRed2DepositorInsertDsRed2
UseCRISPRExpressionMammalianMutationDsRed2 contains a silent nucleotide substitution …Available SinceJuly 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mScarlet-LMNB1
Plasmid#207771PurposeDonor template for mScarlet insertion into the N-terminus of the LMNB1 locus for nuclear envelope visualization. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a mScarlet Tag (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUltra-Exon1Q23-Myc-B
Plasmid#110488PurposeLentiviral vector to express wild-type N terminal HTT gene with partial long 3'UTR in mammalian cells (encodes Myc-tagged wild-type huntingtin exon1 fragment with 23 repeats of Q)DepositorInsertHomo sapiens huntingtin (HTT Human)
UseLentiviralTagsMycExpressionMammalianMutationshort 3'UTR mutant huntingtin exon1 fragment…PromoterUbCAvailable SinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-LAMP1
Plasmid#227322PurposeDonor template for mStayGold insertion into the C-terminus of the LAMP1 locus. For lysosome visualization. To be co-transfected with sgRNA plasmid px330-LAMP1 (Addgene #207787)DepositorInsertLAMP1 Homology Arms flanking a mStayGold Tag (LAMP1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-mStayGold-LMNB1
Plasmid#227329PurposeDonor template for Puro-2A-mStayGold insertion into the N-terminus of the LMNB1 locus. For nuclear envelope visualization. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 (Addgene #207770)DepositorInsertLMNB1 Homology Arms flanking a Puro-2A-mStayGold (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-CETN2
Plasmid#227292PurposeDonor template for mStayGold insertion into the N-terminus of the CETN2 locus. For centriole visualization. To be co-transfected with sgRNA plasmid px330-CETN2 (Addgene #227291)DepositorInsertCETN2 Homology Arms flanking a mStayGold Tag (CETN2 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9-VRQR-P2A-EGFP (RTW3161)
Plasmid#139992PurposeCMV and T7 promoter expression plasmid for human codon optimized SpCas9-VRQR(D1135V/G1218R/R1335Q/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9-VRQR with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationVRQR=D1135V/G1218R/R1335Q/T1337RPromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti_Ef1a:PE2-P2A-GFP
Plasmid#184445PurposeSingle EF1a-driven PE2-P2A-GFP (Addgene #132776) and PaqCI restriction sites for pegRNA cloning. Lentiviral backbone and AmpR.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 and Ef1AAvailable SinceOct. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pMXs-ms-Klf5
Plasmid#50787Purposeretroviral expression of mouse Klf5DepositorAvailable SinceFeb. 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001147380)
Plasmid#80225Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
SPHK1 gRNA (BRDN0001147454)
Plasmid#76813Purpose3rd generation lentiviral gRNA plasmid targeting human SPHK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL3 Zscan4 promoter
Plasmid#69249PurposeLuciferase reporter for Dux4 activation of Zscan4 transcriptionDepositorInsertZscan4 (ZSCAN4 Human)
UseLuciferaseMutationThe two single nucleotide mismatches found betwee…PromoterZscan4Available SinceSept. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBABE hygro MEN1 WT
Plasmid#11024DepositorAvailable SinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only