We narrowed to 30,145 results for: GRN
-
Plasmid#160127PurposeTo express a sgRNA with constant targeting ADE2 by RNA pol II promoter PTEF1DepositorInsertPTEF1-HH-gRNA-ADE2- HDV-TAMO
ExpressionYeastAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_Std_Dual_epegRNA_tevopreQ1
Plasmid#187454PurposeCoselection for prime editing in human cells. Vector for tandem expression of ATP1A1 Q118R-G4 pegRNA with a user-specified epegRNA. pU6-tevopreq1-GG-acceptor-like plasmidDepositorInsertATP1A1 G4 Q118R pegRNA (ATP1A1 Human)
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_Std_Dual_epegRNA_tevopreQ1
Plasmid#187454PurposeCoselection for prime editing in human cells. Vector for tandem expression of ATP1A1 Q118R-G4 pegRNA with a user-specified epegRNA. pU6-tevopreq1-GG-acceptor-like plasmidDepositorInsertATP1A1 G4 Q118R pegRNA (ATP1A1 Human)
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_EBFP_to_EGFP_Dual_pegRNA
Plasmid#178100PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and EBFP_To_EGFP pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + EBFP to EGFP pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_EBFP_to_EGFP_Dual_pegRNA
Plasmid#178100PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and EBFP_To_EGFP pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + EBFP to EGFP pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ATP1A1_G7_Dual_sgRNA
Plasmid#173206PurposeCoselection for HDR in human cells. Vector for dual expression of ATP1A1 G7 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G7 sgRNA + user-specified sgRNA + SpCas9
UseCRISPRExpressionMammalianPromoterDual U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ATP1A1_G7_Dual_sgRNA
Plasmid#173206PurposeCoselection for HDR in human cells. Vector for dual expression of ATP1A1 G7 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G7 sgRNA + user-specified sgRNA + SpCas9
UseCRISPRExpressionMammalianPromoterDual U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
EC2_7_dCas9_HC_sgRNA
Plasmid#163711PurposeHigh copy plasmid with dCas9 and sgRNA expression cassettesDepositorInsertdCas9
ExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
EC2_7_dCas9_HC_sgRNA
Plasmid#163711PurposeHigh copy plasmid with dCas9 and sgRNA expression cassettesDepositorInsertdCas9
ExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA NC
Plasmid#176259PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and spacer sequence on sgRNA is replaced by the type IIS restriction site for endonuclease BaeI andDepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA NC
Plasmid#176259PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and spacer sequence on sgRNA is replaced by the type IIS restriction site for endonuclease BaeI andDepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgRNA.SFFV.RFP657
Plasmid#169939PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and RFP657 from SFFV promoter as the marker for infection. 3rd generation lentiviral backbone.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgRNA.SFFV.RFP657
Plasmid#169939PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and RFP657 from SFFV promoter as the marker for infection. 3rd generation lentiviral backbone.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
LCV2_AAVS1_sgRNA_2
Plasmid#155088Purposelentiviral plasmid expressing Cas9 and gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_AAVS1_sgRNA_2
Plasmid#155088Purposelentiviral plasmid expressing Cas9 and gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_NEMF
Plasmid#127126DepositorInsertgRNA NEMF (NEMF Human)
UseCRISPRAvailable SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_NEMF
Plasmid#127126DepositorInsertgRNA NEMF (NEMF Human)
UseCRISPRAvailable SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_LTN1
Plasmid#127125DepositorInsertgRNA LTN1 (LTN1 Human)
UseCRISPRAvailable SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_LTN1
Plasmid#127125DepositorInsertgRNA LTN1 (LTN1 Human)
UseCRISPRAvailable SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_PELO
Plasmid#127124DepositorInsertgRNA PELO (PELO Human)
UseCRISPRAvailable SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_PELO
Plasmid#127124DepositorInsertgRNA PELO (PELO Human)
UseCRISPRAvailable SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M1S_AmpR
Plasmid#119153PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with one mismatch in the seed regionDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with one mismatch in the seed region
UseCrisprPromoterJ23119Available SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M1S_AmpR
Plasmid#119153PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with one mismatch in the seed regionDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with one mismatch in the seed region
UseCrisprPromoterJ23119Available SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_T2_AmpR
Plasmid#119159PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' endDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' end
UseCrisprPromoterJ23119Available SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_T2_AmpR
Plasmid#119159PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' endDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' end
UseCrisprPromoterJ23119Available SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_T3_AmpR
Plasmid#119160PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' endDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' end
UseCrisprPromoterJ23119Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_T3_AmpR
Plasmid#119160PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' endDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' end
UseCrisprPromoterJ23119Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_T1_AmpR
Plasmid#119158PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' endDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' end
UseCrisprPromoterJ23119Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_T1_AmpR
Plasmid#119158PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' endDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' end
UseCrisprPromoterJ23119Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M4NS_AmpR
Plasmid#119156PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with four mismatches in the non-seed regionDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with four mismatches in the non-seed region
UseCrisprPromoterJ23119Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M4NS_AmpR
Plasmid#119156PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with four mismatches in the non-seed regionDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with four mismatches in the non-seed region
UseCrisprPromoterJ23119Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M1NS_AmpR
Plasmid#119155PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with one mismatch in the non-seed regionDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with one mismatch in the non-seed region
UseCrisprPromoterJ23119Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M1NS_AmpR
Plasmid#119155PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with one mismatch in the non-seed regionDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with one mismatch in the non-seed region
UseCrisprPromoterJ23119Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_pos9_AmpR
Plasmid#119152PurposeEncodes sgRNA targeting position 9 in pColE1_70a_deGFP_KanRDepositorInsertsgRNA targeting position 9 in pColE1_70a_deGFP_KanR
UseCrisprAvailable SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_pos9_AmpR
Plasmid#119152PurposeEncodes sgRNA targeting position 9 in pColE1_70a_deGFP_KanRDepositorInsertsgRNA targeting position 9 in pColE1_70a_deGFP_KanR
UseCrisprAvailable SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_TIAL1
Plasmid#106096PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting TIAL1DepositorInsertgRNA TIAL1
UseCRISPRAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_TIAL1
Plasmid#106096PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting TIAL1DepositorInsertgRNA TIAL1
UseCRISPRAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.shHmga2
Plasmid#32399DepositorAvailable SinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLKO.shHmga2
Plasmid#32399DepositorAvailable SinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
MSCV P2Gm p53
Plasmid#19751DepositorAvailable SinceDec. 18, 2008AvailabilityAcademic Institutions and Nonprofits only -
MSCV P2Gm p53
Plasmid#19751DepositorAvailable SinceDec. 18, 2008AvailabilityAcademic Institutions and Nonprofits only -
pRetrosuper USP28 shRNA-3
Plasmid#15664DepositorAvailable SinceNov. 2, 2007AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRetrosuper USP28 shRNA-3
Plasmid#15664DepositorAvailable SinceNov. 2, 2007AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_ctrA
Plasmid#133339Purposefor constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets ctrA gene's promoter from Caulobacter crescentusDepositorInsertsgRNA_ctrA
UseCRISPRPromoterconstitutiveAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_ctrA
Plasmid#133339Purposefor constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets ctrA gene's promoter from Caulobacter crescentusDepositorInsertsgRNA_ctrA
UseCRISPRPromoterconstitutiveAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEJS469-pLK.O1-SpySgRNA/DTS13-Telomere
Plasmid#85715PurposeTelomere-targeting Spy sgRNA under U6 promoterDepositorInserttelomere sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEJS469-pLK.O1-SpySgRNA/DTS13-Telomere
Plasmid#85715PurposeTelomere-targeting Spy sgRNA under U6 promoterDepositorInserttelomere sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EFS-PCP-3XNeon-nls
Plasmid#75386PurposePCP-3XNeon-nlsDepositorInsertPCP
UseLentiviralTags3XmNeonGreenExpressionMammalianPromoterEFSAvailable SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only