We narrowed to 35,837 results for: CaS;
-
Plasmid#107733PurposeEscherichia coli- S. cerevisiae shuttle plasmid harbors a Cas9 gene, a natMX6 and URA3 selection markers used in S. cerevisiaeDepositorInsertCas9
UseCRISPRTagsSV40 NLSExpressionYeastMutationHuman optimizedPromoterTEF1Available SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMC-6-AtSpCas9-9
Plasmid#197778PurposePhytobrick (MoClo) Level 0 PartDepositorInsertAtSpCas9
ExpressionPlantAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
BPK2013-AkCas12b
Plasmid#121950PurposeE. coli expression, protein purificationDepositorInsertAkCas12b
Tags10xHis tag and 3xHA tagExpressionBacterialAvailable SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAct:dCas9-scFv
Plasmid#78900PurposeExpresses scFv-VP64 under actin promoter for SunTag CRISPRa in Drosophila cellsDepositorInsertscFV-VP64
UseCRISPRTagsGFPExpressionInsectPromoterpActin (Drosophila)Available SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
2X_pX458_pSpCas9(BB)-2A-GFP_NANOG_bKO
Plasmid#172224PurposeCas9-2A-GFP expression vector bearing two sgRNAs targeting the telomeric human NANOG CTCF-boundary.DepositorInsertsgRNA
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-LmoCas8b2
Plasmid#126488PurposeEncodes lentivirus expression of L. monocytogenes CRISPR Type I-B Flag-Cas8b2 driven by hUbC promoterDepositorInsertLmoCas8b2
UseCRISPR and LentiviralTagsFlag, NLSExpressionMammalianPromoterhUbCAvailable SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-LmoCas7
Plasmid#126489PurposeEncodes lentivirus expression of L. monocytogenes CRISPR Type I-B Flag-Cas7 driven by hUbC promoterDepositorInsertLmoCas7
UseCRISPR and LentiviralTagsFlag, NLSExpressionMammalianPromoterhUbCAvailable SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-LmoCas5
Plasmid#126490PurposeEncodes lentivirus expression of L. monocytogenes CRISPR Type I-B Flag-Cas5 driven by hUbC promoterDepositorInsertLmoCas5
UseCRISPR and LentiviralTagsFlag, NLSExpressionMammalianPromoterhUbCAvailable SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-LmoCas6
Plasmid#126491PurposeEncodes lentivirus expression of L. monocytogenes CRISPR Type I-B Flag-Cas6 driven by hUbC promoterDepositorInsertLmoCas6
UseCRISPR and LentiviralTagsFlag, NLSExpressionMammalianPromoterhUbCAvailable SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSW177 - pCASP1
Plasmid#115986Purposeentry vector for GreenGate cloning method, promoterDepositorInsertpCASP1
UseUnspecifiedAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAW-SpyCas1
Plasmid#113248PurposeE. coli expression vector for His-MBP-S. pyogenes Cas1DepositorInsertS. pyogenes Cas1
Tags6xHis-MBPExpressionBacterialPromoterT7Available SinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAW-SpyCas2
Plasmid#113249PurposeE. coli expression vector for His-MBP-S. pyogenes Cas2DepositorInsertS. pyogenes Cas2
Tags6xHis-MBPExpressionBacterialPromoterT7Available SinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
TMPRSS2 g4 + Cas9
Plasmid#153018PurposeA guide RNA targeting TMPRSS2 in a lentiviral plasmid co-expressing Cas9 and TagBFP2DepositorInsertCas9 + TMPRSS2 gRNA
UseCRISPR and LentiviralTagsTagBFP2Available SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
RCAS IkB K->A
Plasmid#12408DepositorInsertIkB alpha K->A (Nfkbia Mouse)
UseRetroviralExpressionMammalianMutationLysines 21, 22, and 67 are mutated to alanine. (T…Available SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLenti_dCas9-2xAM_hIRF-1
Plasmid#92221PurposeLentiviral plasmid expressing dCas9-2xAM and gRNA for human IRF-1 promoterDepositorInsertsSp-dCas9-2xAM tag
gRNA targeting human IRF-1 promoter
UseCRISPR and LentiviralTags2xAM tagExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterCBh and U6Available SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pco-nCASphi_E9t_V2_U6_AtPDS3_gRNA10
Plasmid#197965PurposeT-DNA binary vector to express pco-nCasphi driven by UBQ10 gene promoter, and the AtPDS3 guide RNA 10 driven by U6 promoter.DepositorInsertspco-nCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterAtU6-26 and pUBQ10Available SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
peSpCas9-J23109
Plasmid#113152PurposePlasmid constitutively expressing eSpCas9 proteinDepositorInserteSpCas9
ExpressionBacterialMutationK810A & K1003A & R1060AAvailable SinceDec. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
RCAS Cyp26 (CC#62)
Plasmid#15154DepositorInsertCyp26 (CYP26A1 Chicken)
UseRetroviral; Avian expressionAvailable SinceJune 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCaST-dVP16AD
Plasmid#15306DepositorInsertdVP16AD-ZIP+
ExpressionInsectAvailable SinceJuly 6, 2007AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only