We narrowed to 15,328 results for: EGF
-
Plasmid#86805PurposeLentiviral vector that expresses an EGFP-Cre fusion protein with a nuclear localization signal from the CMV promoterDepositorInsertCre recombinase
UseCre/Lox and LentiviralTagsEGFP and nuclear localization signal: PKKKRKVExpressionMammalianPromoterCMVAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-52: HIST1H2BJ-mEGFP
Plasmid#109121PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human HIST1H2BJDepositorInsertHIST1H2BJ Homology Arms with linker-mEGFP (H2BC11 Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceMay 4, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAVdual-CMV-eGFP
Plasmid#230931PurposepAAVdual plasmid is used to package AAV-CMV-eGFP viruses with the AAVdual system, which integrates the mini-pHelper-1.0 (providing E2A, E4orf6, and VA RNA) with an AAV expression cassette containing eGFP driven by the CMV promoter.DepositorInserteGFP
UseAAVPromoterCMVAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
459 p3E-2A-nlsEGFPpA
Plasmid#195969PurposeGateway p3E 2A fluorophoreDepositorInsert2A-nlsEGFP (nuclear)
UseOtherAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-TDP-43 (NLSmut)
Plasmid#235489PurposeExpression of human TDP-43-EGFP with mutated nuclear localization sequenceDepositorInsertTARDBP (TARDBP Human)
TagsEGFPExpressionMammalianMutationK82A, R83A, K84A, K95A, K97A, R98AAvailable SinceMay 19, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAVtri-CMV-eGFP
Plasmid#230932PurposeUsed for producing AAV-CMV-eGFP viruses with the AAVtri triple-plasmid system. This system combines the use of the mini-pHelper-1.0 and AAV helper plasmids carrying different AAV serotypes.DepositorInserteGFP
UseAAVPromoterCMVAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX333-T2A-EGFP
Plasmid#197417PurposeSpCas9-T2A-EGFP with dual sgRNA cloning backbonesDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCBh; U6Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET24a-LaM4-EGFP
Plasmid#182641PurposeBacterial expression of a functionalized anti-mCherry (LaM4) nanobody fused to EGFP. LaM4-EGFP also contains a T7, HA, BAP and His6 epitopeDepositorInsertanti-mCherry nanobody fused to a T7, HA, BAP and His6 epitope
TagsBAP, EGFP, HA, His6, and T7ExpressionBacterialPromoterT7Available SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVpuro-CMV-N-EGFP
Plasmid#122848PurposeN-terminal EGFP tag. Gateway destination vector for lentivirus production and stable transduction in mammalian cells.DepositorTypeEmpty backboneUseGateway Cloning and LentiviralTagsEGFPExpressionMammalianPromoterCMVAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBactin-Akna-mEGFP
Plasmid#196866PurposeExpression of the centrosomal protein Akna fused to enhanced (E)-GFPDepositorInsertAkna-mEGFP (Akna Mouse)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFX-mito-EGFP
Plasmid#159096PurposeExpress EGFP with mitochondria-targeting sequence in mammalian cellsDepositorInsertmCherry with mitochondria-targeting sequence
Tagsthe mitochondria-targeting sequence of the cytoch…ExpressionMammalianPromoterCMVAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-60: SOX2-mEGFP
Plasmid#124606PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human SOX2DepositorInsertSOX2 Homology Arms with linker-mEGFP (SOX2 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceMay 13, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMTTH+mEGFP-H1.4
Plasmid#157799PurposeExpression of mEGFP and human linker histone H1.4 fusion proteinDepositorAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-EGFP-tDeg
Plasmid#185400PurposeEGFP-tDeg fluorogenic proteinDepositorInsertEGFP-tDeg
ExpressionMammalianMutationWTPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti6-DCX-EGFP
Plasmid#80599PurposepLenti6 destination vector encoding C-terminally EGFP-tagged human doublecortin (DCX; GenBank: NM_178152)DepositorAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV-Nppa-EGFP
Plasmid#247327PurposeExpresses EGFP under the control of the Nppa promoterDepositorInsertEGFP under the control of the Nppa Promoter
UseAAVExpressionMammalianPromoterNppa proximal promoterAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28a-EGFP-CNA35
Plasmid#61603Purposebacterial expression of N-terminal fusion protein of CNA35 with EGFPDepositorInsertEGFP and CNA35
TagsHis tagsExpressionBacterialPromoterT7Available SinceMarch 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-meGFP-Myo6
Plasmid#225227PurposeExpresses GFP-tagged Myo6DepositorAvailable SinceFeb. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMRX-mSTING-EGFP
Plasmid#214148PurposeRetroviral transduction of EGFP-tagged STINGDepositorAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
EGF-bio-His
Plasmid#53340PurposeExpresses full-length Pro-epidermal growth factor precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertEGF (EGF Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-EGFP-SOS1
Plasmid#178860PurposeMammalian expression of SOS1 fused to EGFPDepositorAvailable SinceJuly 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Map7-fulllength
Plasmid#46076DepositorAvailable SinceJuly 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 Raptor Halo
Plasmid#112754Purposeexpress Raptor-HaloDepositorAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-RhoA Biosensor
Plasmid#68026PurposeC-terminus of Anillin in mammalian expression vector pEGFP-C1DepositorAvailable SinceSept. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
PT3.5/CMV-EGFRvIII
Plasmid#20280DepositorAvailable SinceDec. 3, 2009AvailabilityAcademic Institutions and Nonprofits only -
pFYF1320 EGFP Site#1
Plasmid#47511Purposehuman gRNA expression vector targeting EGFPDepositorInsertgRNA-EGFP site 1
UseCRISPRExpressionMammalianPromoterU6Available SinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCSC-NLS-EGFP
Plasmid#221811PurposeLentiviral vector expressing green fluorescent protein (GFP) fused with nuclear localization sequence (NLS)DepositorInsertNLS-EGFP
UseLentiviralTagsNLSExpressionMammalianPromoterCMVAvailable SinceJuly 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1
Plasmid#37370DepositorAvailable SinceAug. 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
MCP-EGFP-PiggyBac
Plasmid#190003PurposeExpression of MCP-EGFP in mammalian cells. To clone this plasmid, Addgene plasmid #119908 was used. We replaced the tandem coat proteins and double tagRFP with a single coat protein fused to EGFP.DepositorInsertMCP-EGFP
Available SinceNov. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
eGFP STAT1 Y701F
Plasmid#12302DepositorAvailable SinceSept. 1, 2006AvailabilityAcademic Institutions and Nonprofits only