We narrowed to 11,250 results for: streptococcus -(crispr) -(cas9)
-
Plasmid#169597PurposeTier-1 vector encoding PhCMV-driven dCas9-3xNLS-VP64 expression (PhCMV-dCas9-3xNLS-VP64-pA).DepositorInsertdead S.pyogenes Cas9 - VP64 fusion
ExpressionMammalianPromoterPhCMVAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRIS-PITChv2-FBL
Plasmid#63672PurposePITCh donor vector for EGFP-2A-PuroR knock-in into human FBL locusDepositorInsertEGFP-2A-PuroR
UseCRISPRPromoterPromoterlessAvailable SinceDec. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLX-sgRNA
Plasmid#50662PurposeLentiviral expression of AAVS1-targeting sgRNA; insert can be replaced with custom sgRNA (see protocol)DepositorInsertsgAAVS1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pX601-GFP
Plasmid#84040PurposeStaphylococcus aureus (SaCas9) conjugated with GFPDepositorInsertSaCas9
UseAAV and CRISPRTagsNLS and T2A-EGFPExpressionMammalianPromoterCMVAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHAGE EF1α dCas9-KRAB
Plasmid#50919PurposeConstitutive dCas9-KRAB 2nd generation lentiviral expression vectorDepositorInsertdCas9
UseCRISPR and LentiviralTags3xHA and KRABExpressionMammalianMutationD10A, H840APromoterEF1alphaAvailable SinceMarch 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
MS2-P65-HSF1_GFP
Plasmid#61423PurposeExpresses the MS2-P65-HSF1 activator helper complex with a 2A GFP. 3rd generation lentiviral vector.DepositorInsertMS2(N55K)-P65-HSF1_2A_GFP (HSF1 Human, Synthetic)
UseCRISPR and LentiviralExpressionMammalianMutationN55K in MS2PromoterEF1AAvailable SinceDec. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
Cas9m4-VP64
Plasmid#47319PurposeCas9m4 ActivatorDepositorInsertCas9m4-VP64
UseCRISPRAvailable SinceAug. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1179 U6-reci Gag-Cas9 v2
Plasmid#201914PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-Cas9 v2
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
gRNA_GFP-T1
Plasmid#41819PurposeExpresses a guide RNA (gRNA) to target GFP (T1 target sequence) for genome engineeringDepositorInsertgRNA_GFP-T1
UseCRISPRExpressionMammalianAvailable SinceJan. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHAGE TRE dCas9-VP64
Plasmid#50916PurposeTet-regulatable dCas9-VP64 2nd generation lentiviral expression vectorDepositorInsertdCas9
UseCRISPR and LentiviralTags3xHA and VP64ExpressionMammalianMutationD10A, H840A nuclease-deficientPromoterTREAvailable SinceMarch 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
dCAS9-VP64_GFP
Plasmid#61422PurposeExpresses dCAS9-VP64 activator with 2A GFPDepositorHas ServiceConcentrated Lentiviral PrepInsertdCAS9(D10A,H840A)-VP64_2A_GFP
UseCRISPR and LentiviralExpressionMammalianMutationD10A and H840A in Cas9PromoterEF1AAvailable SinceDec. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-createR194G-A6-gRNA_(CJT88)
Plasmid#226987PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-R194G cell line via adenine base editing (target base in position A6)DepositorInsertSpCas9 gRNA A6 to create OPA1-R194G
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-createR194G-A7-gRNA_(CJT89)
Plasmid#226986PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-R194G cell line via adenine base editing (target base in position A7)DepositorInsertSpCas9 gRNA A7 to create OPA1-R194G
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-createR194G-A9-gRNA_(CJT87)
Plasmid#226988PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-R194G cell line via adenine base editing (target base in position A9)DepositorInsertSpCas9 gRNA A9 to create OPA1-R194G
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHEE401E
Plasmid#71287PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistanceDepositorInsertsgRNA scaffold
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 enhancer fused to EC1.1 promoter and U6-26p…Available SinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
xCas9 3.7
Plasmid#108379PurposeMammalian expression vector for xCas9 3.7DepositorInsertxCas9 3.7
TagsNLSExpressionMammalianMutationA262T, R324L, S409I, E480K, E543D, M694I, E1219VAvailable SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
gRNA_AAVS1-T1
Plasmid#41817PurposeExpresses a guide RNA (gRNA) to target human AAVS1 (T1 target sequence) for genome engineeringDepositorInsertgRNA_AAVS1-T1
UseCRISPRExpressionMammalianAvailable SinceJan. 11, 2013AvailabilityAcademic Institutions and Nonprofits only