We narrowed to 2,589 results for: GCG
-
Plasmid#65599Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APs12
UseCRISPRExpressionWormPromoterU6Available SinceJune 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP54-3
Plasmid#65597Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APs12
UseCRISPRExpressionWormPromoterU6Available SinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
PX459-TP53-exon5
Plasmid#217456PurposeFor TP53 knockout targeting exon 5 of TP53DepositorAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Tubb3-GFP KI
Plasmid#131497PurposeEndogenous tagging of β3 Tubulin: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGrin1
Plasmid#124852PurposeMutagenesis of Grin1DepositorInsertGrin1 (Grin1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
PKMYT1 gRNA (BRDN0001146750)
Plasmid#77280Purpose3rd generation lentiviral gRNA plasmid targeting human PKMYT1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV(gfp)U6sgRNA5(BbsI)-PGKpuroBFP
Plasmid#102798PurposeRetrovirus for delivery of one sgRNA (self-targeting) - GFP-targeting control plasmid contains GFP instead of PuroRDepositorInsertssgRNA
EGFP
UseCRISPR and RetroviralExpressionMammalianMutationH231LAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-SNRNP70_sgRNA1
Plasmid#201620PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertSNRNP70 (SNRNP70 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-SNRNP70_sgRNA2
Plasmid#201621PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertSNRNP70 (SNRNP70 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
-
pLentiCRISPR-v1-sgDHFR
Plasmid#233898Purposelentiviral vector expressing Cas9 and an sgRNA targeting DHFRDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2 sgIRF3#5
Plasmid#127642PurposeKnock-out of human IRF3DepositorInsertIRF3 sgRNA (IRF3 Human)
UseLentiviralAvailable SinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
Control-Control-LRG-GFP
Plasmid#225873PurposeTwo copies of guide RNA targeting a control sequenceDepositorInsertControl
UseCRISPR and LentiviralAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-HDAC1 ts1
Plasmid#115852PurposeHDAC1 knockdownDepositorAvailable SinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
PKMYT1 gRNA (BRDN0001148430)
Plasmid#77279Purpose3rd generation lentiviral gRNA plasmid targeting human PKMYT1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX458-GFP-TRIM28
Plasmid#185010PurposeEncodes gRNA for mouse TRIM28 along with Cas9 with 2A-EGFPDepositorInsertTRIM28 sgRNA (Trim28 Mouse)
UseCRISPRAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only