We narrowed to 7,330 results for: Ank
-
Plasmid#170197PurposeMammalian expression of SARS-CoV-2 soluble spike trimer protein (B.1.1.7 variant)DepositorInsertSARS-CoV-2 S (spike) B.1.1.7 (S SARS-CoV-2)
TagsHis6ExpressionMammalianMutationΔ(69-70), Δ144, N501Y, A570D, D614G, P681H, T716I…PromoterCMV51Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-(Spyo_Cas9)-6xHis-NLS(SV40)
Plasmid#185706PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(Spyo_Cas9) with an N-terminal NLS and C-terminal NLSDepositorInsertCas9
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
FUW TetO HA-AMPKa2 WT
Plasmid#69826PurposeExpresses AMPK alpha 1 in mammalian cells in a doxycycline inducible mannerDepositorInsert5'-AMP-activated protein kinase catalytic subunit alpha-2 (PRKAA2 Human)
UseLentiviralTagsHAExpressionMammalianPromoterminimal CMV promoter with tetracycline operatorAvailable SinceMay 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-V5-SHLD3
Plasmid#114124PurposeExpresses N-terminally tagged V5-SHLD3 in mammalian cellsDepositorInsertSHLD3 (SHLD3 Human)
UseGenomic integration, tetracycline inducibleTagsV5ExpressionMammalianPromoterCMV/TetO2Available SinceAug. 23, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
VARP GFP-pLXIN
Plasmid#62950Purposefull length human VARP with C-terminal EGFP tag cloned into pLXINDepositorInsertVARP (ANKRD27 Human)
UseRetroviralTagsEGFPExpressionMammalianMutationsilent mutations of amino acids 422-428 to produc…PromoterLTRAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCJ209
Plasmid#162682PurposeLidless variant of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1) replacing Gly251:Thr472 of MHETase with the 7-residue loop (Trp185:Phe191, PETase numbering) of PETase , codon optimized for expression in E. coli K12, with C-terminal His tag.DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1) with the lid removed
TagsHisExpressionBacterialMutationReplacement of G251-T472 with W185-F191 from PETa…PromoterT7/lacAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCW57-mCherry-2A-BRD4 Iso AdelCTD
Plasmid#137722PurposeDoxycycline Inducible Expression of mCherry-2A-FLAG-BRD4 long isoform missing its C-terminal, P-TEFb interacting domain (CTD)DepositorInsertBRD4 long isoform without its C-terminal, P-TEFb interacting domain (BRD4 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationTruncated at amino acid 1328PromoterTight TRE promoterAvailable SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
TMEM230-WT-pEGFP(isoform 2)
Plasmid#99562Purposemammalian expression of TMEM230-GFP (isoform 2)DepositorAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
R620-M14-303: CMV51p> SARS-CoV-2 S(1-1213)-2P-T4f-His6 B.1.351
Plasmid#170198PurposeMammalian expression of SARS-CoV-2 soluble spike trimer protein (B.1.351 variant)DepositorInsertSARS-CoV-2 S (spike) B.1.351 (S SARS-CoV-2)
TagsHis6ExpressionMammalianMutationL18F, D80A, D215G, Δ(242-244), R246I, K417N, E484…PromoterCMV51Available SinceMay 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-MCU-mCerulean
Plasmid#185809PurposeHuman mitochondrial calcium uniporter with C-terminus mCerulean tagDepositorInsertMitochondrial calcium uniporter (MCU Human)
UseLentiviralTagsmCeruleanExpressionMammalianPromoterCMVAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX304-GFP-IQSEC1 v2-E620K GEF dead mutant
Plasmid#162020PurposeExpression of GEF dead IQSEC1 mutantDepositorAvailable SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCJ206
Plasmid#162679PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating the E226T mutation to the putative lipase box.DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), incorporating the E226T mutation to the putative lipase box
TagsHisExpressionBacterialMutationE226T; codon optimized for expression in E. coli …PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CMV-PdCO-EGFP
Plasmid#198512PurposeExpresses optimized PdCO in frame with EGFP under control of CMV promotor.DepositorInsertPdCO
TagsEGFP and Rho1D4ExpressionMammalianPromoterCMVAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCJ211
Plasmid#162684PurposepET-21b(+) based plasmid for expression of the putative MHETase from Hydrogenophaga sp. PML113 (Genbank WP_083293388.1) with deletion of the predicted signal peptide (Lys2:Gly19), with C-terminal His tag, codon optimized for expression in E. coli K12.DepositorInsertPutative MHETase from Hydrogenophaga sp. PML113 (Genbank WP_083293388.1) without 19 residue signal peptide
TagsHisExpressionBacterialMutationdeltaK2:G19; codon optimized for expression in E.…PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEMS1503
Plasmid#29299PurposeHomologous recombination plasmid for gene targeting at the mouse Hprt locus containing Ple32 (CLDN5 MiniPromoter) driving a lacZ reporter.DepositorInsertPle32 (CLDN5 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceJune 10, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
TMEM230-WT-pEGFP(isoform 1)
Plasmid#99561Purposemammalian expression of TMEM230-GFP (isoform 1)DepositorAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
TMEM230-WT-IRES(isoform 2)
Plasmid#99564Purposemammalian expression of TMEM230 (isoform 2) and ZsGreenDepositorAvailable SinceAug. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCW57-mCherry-2A-BRD4 Iso CdelET
Plasmid#137723PurposeDoxycycline Inducible Expression of mCherry-2A-FLAG-BRD4 long short missing its extra-terminal domain (ET)DepositorInsertBRD4 short isoform with deleted extra-terminal domain (BRD4 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationDeleted amino acids 600-682PromoterTight TRE promoterAvailable SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLX307/PTPN11 T73I
Plasmid#140939Purposeexpresses PTPN11 T73IDepositorInsertPTPN11 protein tyrosine phosphatase non-receptor type 11 [ Homo sapiens (human) ] (PTPN11 Human)
TagsV5ExpressionMammalianMutationT73IPromoterEF1aAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ACE2 receptor 19-615
Plasmid#167012PurposeGateway-compatible Entry vector encoding ACE2 receptor (aa19-615) interacting with spike (S1) RBD domain from SARS-CoV-2DepositorAvailable SinceMarch 29, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
R620-M01-303: CMV51p> SARS-CoV-2 S(1-1208)-2P-T4f-3C-His8-Strep2x2 B.1.1.7
Plasmid#170188PurposeMammalian expression of SARS-CoV-2 soluble spike trimer protein (B.1.1.7 variant)DepositorInsertSARS-CoV-2 S (spike) B.1.1.7 (S SARS-CoV-2)
Tags3C-His8-Strep2x2ExpressionMammalianMutationΔ(69-70), Δ144, N501Y, A570D, D614G, P681H, T716I…PromoterCMV51Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLX307/PTPN11 E76G
Plasmid#140862Purposeexpresses PTPN11 E76GDepositorInsertPTPN11 protein tyrosine phosphatase non-receptor type 11 [ Homo sapiens (human) ] (PTPN11 Human)
ExpressionMammalianMutationE76GPromoterEF1aAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
TMEM230-WT-IRES(isoform 1)
Plasmid#99558Purposemammalian expression of TMEM230 (isoform 1) and ZsGreenDepositorAvailable SinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEMS1494
Plasmid#29242PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle23 (CCKBR Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceNov. 7, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1593
Plasmid#29270PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle122 (ICMT Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceOct. 28, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLV[Exp]-Bsd-CMV>hCDK11A
Plasmid#239212PurposeExpresses CDK11A in mammalian cell linesDepositorAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
CL20_MSCV-ires-GFP
Plasmid#237496PurposeRetroviral empty vectorDepositorTypeEmpty backboneUseRetroviralExpressionMammalianAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-TR-hCAII
Plasmid#232480PurposeTetracycline inducible PiggyBac vector expressing human CAII gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertHuman carbonic anhydrase II (CA2 Human)
UseTransposon systemTagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCMV-TetOAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHLsec hSOD1
Plasmid#232481Purposevector for transient transfection expressing human SOD1gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertHomo sapiens superoxide dismutase 1 (SOD1 Human)
TagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCAGAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
OMM-short-RspA-CFAST
Plasmid#233594PurposeExpression of RspA-CFAST on the outer mitochondrial membraneDepositorInsertTOM70 fragment-RspA-CFAST (TOMM70 RspA-CFAST from Rheinheimera sp A13L and TOM70 fragment from Homo sapiens, Human)
ExpressionMammalianPromoterCMVAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
STIM1-RspA-NFAST
Plasmid#233606PurposeExpression of hSTIM1-RspA-NFASTDepositorAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-hs737
Plasmid#222472PurposeLuciferase vector containing the hs737 enhancer sequence (reference sequence).DepositorAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCI AscI MR1 res
Plasmid#214752Purposeexpresses human MR1 resistant to CRISPR editing with a specific sgRNA in mammalian cellsDepositorInsertMHC class I-related protein 1 (MR1 Human)
TagsIRES eGFPExpressionMammalianMutationsilent mutations to prevent editing by CRISPR/Cas…PromoterCMVAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-TNFSF11-Fc(DAPA)-AviTag-6xHis
Plasmid#156700PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertTNFSF11 (TNFSF11 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
mGFP-hNET-A457P
Plasmid#193365Purposeexpression of mutated human norpinephrine transporter tagged with monomeric GFP at the N-terminus in mammalian cellsDepositorInserthuman Norepinephrine Transporter (A457P mutation) (SLC6A2 Human)
Tagsmonomeric GFP (mGFP)ExpressionMammalianMutationA457P (GCC to CCC)PromoterCMVAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
mGFP-hNET-R121A/K334A/R440A
Plasmid#193366Purposeexpression of mutated human norpinephrine transporter tagged with monomeric GFP at the N-terminus in mammalian cellsDepositorInserthuman Norepinephrine Transporter (SLC6A2 Human)
Tagsmonomeric GFP (mGFP)ExpressionMammalianMutationR121A (CGG to GCG) K334A (AAA to GCA) R440A (CGA …PromoterCMVAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1-del1097-1110-IKGRQtoDSYAA-shRNAres_W
Plasmid#147897PurposeMammalian Expression of HsNot1iso1-del1097-1110-IKGRQtoDSYAA-shRNAresDepositorInsertHsNot1iso1-del1097-1110-IKGRQtoDSYAA-shRNAres (CNOT1 Human)
ExpressionMammalianMutation10 silent mutations and two non silent N605S, K75…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1-del1097-1110-NF1144AA-shRNAres_W
Plasmid#147898PurposeMammalian Expression of HsNot1iso1-del1097-1110-NF1144AA-shRNAresDepositorInsertHsNot1iso1-del1097-1110-NF1144AA-shRNAres (CNOT1 Human)
ExpressionMammalianMutation1 silent mutation and one non silent mutation R23…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1-del1097-1110-R1138A-shRNAres_W
Plasmid#147899PurposeMammalian Expression of HsNot1iso1-del1097-1110-R1138A-shRNAresDepositorInsertHsNot1iso1-del1097-1110-R1138A-shRNAres (CNOT1 Human)
ExpressionMammalianMutation1 silent mutation and one non silent mutation R23…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1_1-1605-del1079-1110-RNFtoAAA-shRNAres_W
Plasmid#147886PurposeMammalian Expression of HsNot1iso1_1-1605-del1097-1110-RNFtoAAA-shRNAresDepositorInsertHsNot1iso1_1-1605-del1097-1110-RNFtoAAA-shRNAres (CNOT1 Human)
ExpressionMammalianMutation1 silent mutation compared to the sequence of iso…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1_1-1605-del1097-1110-RNFIKGRQtoAAADSYAA-shRNAres_W
Plasmid#147887PurposeMammalian Expression of HsNot1iso1_1-1605-del1097-1110-RNFIKGRQtoAAADSYAA-shRNAresDepositorInsertHsNot1iso1_1-1605-del1097-1110-RNFIKGRQtoAAADSYAA-shRNAres (CNOT1 Human)
ExpressionMammalianMutation1 silent mutation compared to the sequence of iso…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-nE-mHP1alpha
Plasmid#181895PurposeFluorescently tagged HP1alpha, serines in N-terminal extension (NTE) replaced by glutamatesDepositorInsertnE-mHP1alpha (Cbx5 Mouse)
TagsGFPExpressionMammalianMutationS11E, S12E, S13E, S14EPromoterCMVAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(FCA)-6xHis-NLS(SV40)
Plasmid#185701PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(FCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(FCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(PDCA)-6xHis-NLS(SV40)
Plasmid#185705PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(PDCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(PDCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(SCA)-6xHis-NLS(SV40)
Plasmid#185703PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(SCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(SCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(PCA)-6xHis-NLS(SV40)
Plasmid#185704PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(PCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(PCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(BCA)-6xHis-NLS(SV40)
Plasmid#185702PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(BCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(BCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only