32,114 results
-
Plasmid#248590PurposeN-term GST tag E2 variant selected for HOIPDepositorInsertpGEX-GST-L3HP-1
TagsGSTExpressionBacterialAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
GST-tag LUBAC binding E2 variant D3LU-2
Plasmid#248591PurposeN-term GST tag E2 variant selected for LUBACDepositorInsertpGEX-GST-D3LU-2
TagsGSTExpressionBacterialAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
GST-tag HOIL1 binding E2 variant L3HL-1
Plasmid#248855PurposeN-term GST tag E2 variant selected for HOIL1DepositorInsertGST-L3HL-1
TagsAvi and GSTExpressionBacterialAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
GST-tag LUBAC binding E2 variant L3LU-1
Plasmid#248856PurposeN-term GST tag E2 variant selected for LUBACDepositorInsertGST-L3LU-1
TagsGSTExpressionBacterialAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
GST-tag LUBAC binding E2 variant L3LU-2
Plasmid#248857PurposeN-term GST tag E2 variant selected for LUBACDepositorInsertGST-L3LU-2
TagsGSTExpressionBacterialAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
GST-tag LUBAC binding E2 variant D3LU-1
Plasmid#248858PurposeN-term GST tag E2 variant selected for LUBACDepositorInsertGST-D3LU-1
TagsGSTExpressionBacterialAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pET20b-His6-LONP1-Pore Loop 2 mutant (Y599A)
Plasmid#247939PurposeExpression of human LONP1 with methionine 115 as its first residue (mature mitochondrial-matrix localized form) Pore Loop 2 mutant (Y599A)DepositorInsertLONP1 (LONP1 Human)
Tags6xHisExpressionBacterialMutationencodes aa 115-959, with Y599APromoterT7Available SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET20b-His6-LONP1
Plasmid#247937PurposeExpression of human LONP1 with methionine 115 as its first residue (mature mitochondrial-matrix localized form)DepositorAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET20b-His6-LONP1-Walker B mutant (E591A)
Plasmid#247938PurposeExpression of human LONP1 with methionine 115 as its first residue (mature mitochondrial-matrix localized form) and Walker B mutant (E591A)DepositorInsertLONP1 (LONP1 Human)
Tags6xHisExpressionBacterialMutationencodes aa 115-959, with E591APromoterT7Available SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-3-GST-Tev-Af1521(K35E/Y145R)-myc
Plasmid#196241PurposeN-terminal GST fusion of Af1521(K35E/Y145R) with a TEV protease site located between the GST tag and Af1521 and a myc tag on the C terminusDepositorInsertN-terminal GST fusion of Af1521(K35E/Y145R) with a TEV protease site between GST and Af1521 encoding a C-terminal myc tag
TagsGST tag and myc tagExpressionBacterialMutationamino acid 35 lysine is replaced with glutamic ac…Available SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
MZB053
Plasmid#217835PurposeBacterial expression of human AP3B1 (1-677) and AP3M1 AP-3 core hemicomplexDepositorTagsGSTExpressionBacterialMutationRemoved residues 678-1094 from AP3B1Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
WNV NS2B-NS3 protease (catalytically active, self cleave); aliases: West Nile Virus NS2B-NS3 fusion protein
Plasmid#204795PurposeBacterial expression of a fusion of West Nile NS2B-NS3 proteinsDepositorInsertWest Nile NS2B-NS3 fusion
ExpressionBacterialAvailable SinceAug. 29, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
NBla_1.2_EmrE_TMD4_3P_G90V_G97V
Plasmid#207847PurposeBLaTM-System; Antiparallel negativecontrol EmrE_TMD4_3P_G90V_G97V in NBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBla_1.2_EmrE_TMD4_3P
Plasmid#207846PurposeBLaTM-System; Antiparallel positive control EmrE_TMD4_3P in NBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBla_1.2_GpA_wt
Plasmid#207842PurposeBLaTM-System GpA wt positive control in NBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
CBLa_1.2_GpA_wt
Plasmid#207843PurposeBLaTM-System GpA wt positive control in CBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEVA251_ Ptrc.x.tetO2::D-HicDH
Plasmid#185456PurposeCDS of D-HicDH codon optimized for expression in Synechocystis sp. PCC 6803 under the control of the synthetic promoter Ptrc.x.tetO2 and the RBS BBa_B0030 in pSEVA251 plasmid.DepositorInsertD-HicDH from Lactobacillus paracasei DSM 20008
ExpressionBacterialPromoterPtrc.x.tetO2Available SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTn7-SCOUT11
Plasmid#200991PurposepLv1-pUC18R6KT-miniTn7-Gm, GmR, ApRDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lac-I-SceI-Tet
Plasmid#17655DepositorInsertlac I-SceI tet
ExpressionBacterialAvailable SinceMay 30, 2008AvailabilityAcademic Institutions and Nonprofits only -
pDest-566
Plasmid#11517DepositorTypeEmpty backboneUseGateway destination vectorTags6xHis and MBPExpressionBacterialPromoterT7-lacO (lactose/IPTG inducible)Available SinceMay 24, 2006AvailabilityAcademic Institutions and Nonprofits only -
pET29b_mNeonGreen
Plasmid#209425PurposeExpress mNeonGreen in E. coliDepositorInsertmNeonGreen
Tags6xHisExpressionBacterialAvailable SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYUB1062-GFP
Plasmid#117695PurposeExpress recombinant proteins with GFP-His fusion in Mycobacterium smegmatisDepositorTypeEmpty backboneTagsGFP and HisExpressionBacterialAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKD236-4b
Plasmid#90956PurposeExpresses ThsS constitutivelyDepositorInsertThsS
ExpressionBacterialPromoterBba_J23104Available SinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
WDV-Echistatin
Plasmid#226985PurposeExpresses the HUH endonuclease WDV fused at the C termini with Echistatin to target RGD binding integrins with DNA tension sensorsDepositorAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
PARP1 FL
Plasmid#169815PurposeExpresses codon optimised full length His tagged PARP1 in bacterial cellsDepositorInsertPoly[ADP-ribose] polymerase 1 (PARP1 Synthetic, Human, Codon optimised)
TagsMKHHHHHHMKQExpressionBacterialMutationValine 762 mutated to an alaninePromoterT7 promoterAvailable SinceAug. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCV006-ermg
Plasmid#232824PurposeRandom transposon mutagenesis vector for Bacteroidales species - erythromycinDepositorInsertermG
ExpressionBacterialAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
RBD#4L
Plasmid#193021PurposehnRNP C RRM RNA binding domain inserted in between N415 and N416 of Loop 1 of LwaCas13aDepositorInsertCas13a
TagshnRNP C RRMExpressionBacterialAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMV306hsp+FFluc
Plasmid#26156DepositorInsertFirefly luciferase
ExpressionBacterialMutationFirefly luciferase gene codon optimised for mycob…Available SinceFeb. 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
pTriEx-mCherry-LOV2
Plasmid#81041PurposeMammalian or insect expression for wt LOV2DepositorInsertLOV2
TagsmCherryExpressionBacterial, Insect, and Mamm…PromoterCMV, p10Available SinceAug. 17, 2016AvailabilityAcademic Institutions and Nonprofits only