We narrowed to 5,947 results for: crispr cas9 expression plasmids
-
Plasmid#108687PurposePlasmid for assembly of donor DNA templates consisting of three expression unitsDepositorTypeEmpty backboneExpressionBacterial and YeastAvailable SinceAug. 24, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pQCH
Plasmid#164160PurposeIncQ BHR plasmidDepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CMV-SV40NLS-OgeuIscBE193A-3XHA
Plasmid#222861PurposeThis plasmid codes for the OgeuIscB nickaseDepositorInsertOgeuIscB Nickase
UseCRISPRTags3X HA and Nucleoplasmin NLS and ITR2ExpressionMammalianMutationE193A for nickase mutationPromoterCMVAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pROS13
Plasmid#107927Purposekan based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSP571
Plasmid#139498PurposeCRISPR-Cas9 plasmid to generate double strand break in STL1 locus in S. cerevisiae. Expresses both Cas9 and STL1 sgRNADepositorInsertpGPD Cas9 / sgRNA (STL162)
ExpressionYeastMutationWTPromoterpGPDAvailable SinceJune 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_502
Plasmid#96923Purposefor CRISPRa, lentiviral expression of gRNA scaffold using activator P65 HSFDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYN2_1
Plasmid#184757PurposePlasmid for genome editing by CRISPR/Cas9DepositorInsertsCas9
sgRNA scaffold where sfGFP is replaced with gRNA protospacer of interest, which will be proceeded by the HDV Ribozyme
UseSynthetic BiologyTags2xNLSExpressionBacterial and YeastPromoterPGK1 and tRNA-Phe-HDV RibozymeAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTJK459
Plasmid#138008PurposeEmpty sgRNA expression vector for expression of sgRNA for Sp Cas9DepositorTypeEmpty backboneUseLentiviralMutationU-A flip and hairpin extension: cgtttAagagctaTGCT…Available SinceMay 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMLS328
Plasmid#73717PurposeC. elegans germline CRE expression vectorDepositorInsert2xNLS-CRE
UseCre/LoxExpressionWormPromoterPeft-3Available SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAS_sfGFP150K
Plasmid#193313PurposepAS control plasmid for sfGFP expressionDepositorInsertsuper folder GFP
ExpressionMammalianMutation150K in sfGFPPromoterEF1Available SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKM197
Plasmid#132665PurposepyrE-targeted CRISPR-Cas9 control plasmid. Cas9 expression is controlled by the xylR promoter and results in improved conjugation efficiency. Induction with xylose results in a pyrE mutant.DepositorInsertUpstream & Downstream pyrE deletion region
UseE. coli - c. difficile shuttle vectorAvailable SinceOct. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-Stuffer
Plasmid#106248PurposeDestination vector for U6::gRNA expression cassetteDepositorTypeEmpty backboneUseAAVAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAS_gpyrG1
Plasmid#90276Purpose(also pMST621-BB3_gpyrG1_cas9) CRISPR/Cas9 plasmid with gRNA for pyrG1, Cas9DepositorInsertgRNA (pyrg1)
UseA. nigerExpressionBacterialAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAS_gpyrG2
Plasmid#90277Purpose(also pMST620-BB3_gpyrG2_cas9) CRISPR/Cas9 plasmid with gRNA for site pyrG2, Cas9DepositorInsertgRNA (pyrg2)
UseA. nigerExpressionBacterialAvailable SinceDec. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV CMV-driven AcrIIA4-scaffold (2xBsmBI sites)
Plasmid#120297PurposeAAV vector for expression of AcrIIA4 (no miR binding sites, control vector)DepositorInsertAcrIIA4
UseAAV and CRISPRTagsFLAGExpressionMammalianAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV CMV-driven AcrIIA4-2xmiR-122 target sites
Plasmid#120298PurposeAAV vector for expression of AcrIIA4 with two miR-122 binding sitesDepositorInsertAcrIIA4-2xmiR-122 binding sites
UseAAV and CRISPRTagsFLAGExpressionMammalianAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV CMV-driven AcrIIA4-2xmiR-1 target sites
Plasmid#120299PurposeAAV vector for expression of AcrIIA4 with two miR-1 binding sitesDepositorInsertAcrIIA4-2xmiR-1 binding sites
UseAAV and CRISPRTagsFLAGExpressionMammalianAvailable SinceJan. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV CMV-driven AcrIIC1-2xmiR-122 target sites
Plasmid#120302PurposeAAV vector for expression of AcrIIC1 with two miR-122 binding sitesDepositorInsertAcrIIC1-2xmiR-122 binding sites
UseAAV and CRISPRExpressionMammalianAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV CMV-driven AcrIIC3-2xmiR-122 target sites
Plasmid#120303PurposeAAV vector for expression of AcrIIC3 with two miR-122 binding sitesDepositorInsertAcrIIC3-2xmiR-122 binding sites
UseAAV and CRISPRExpressionMammalianAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
IL1RN gRNA1
Plasmid#113130PurposeExpresses gRNA targeting the IL1RN promoter (SpyCas9 scaffold)DepositorInsertIL1RN guideRNA 1 (SpCas9 scaffold), co-expressed GFP (transfection marker)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianPromoterU6 for gRNA expression, RSV for GFP expressionAvailable SinceMarch 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEL666
Plasmid#196814PurposeLrCas9 genome editing plasmid in riceDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterZmUbiAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEL667
Plasmid#196815PurposeLrCas9 genome editing plasmid in wheatDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterZmUbiAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEL668
Plasmid#196816PurposeLrCas9 genome editing plasmid in larixDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterLrk004PAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEL669
Plasmid#196817PurposeLrCas9 genome editing plasmid in tomatoDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterSlEF1aAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
HCP4
Plasmid#166106PurposeThis plasmid encodes a Cas9 protein as well as two sgRNAs, one targets the center of Cyr1 and the other targets a non-coding region on chromosome X (location X1)DepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
HCP6
Plasmid#166108PurposeThis plasmid encodes a Cas9 protein as well as two sgRNAs, one targets the C-terminus of Cyr1 and the other targets a non-coding region on chromosome X (location X1)DepositorAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
IL1RN gRNA4
Plasmid#113133PurposeExpresses gRNA targeting the IL1RN promoter (SpyCas9 scaffold)DepositorInsertIL1RN guideRNA 4 (SpCas9 scaffold), co-expressed GFP (transfection marker)
UseAAV, Synthetic Biology, and TALENExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJRH051
Plasmid#171625Purpose2nd generation lentiviral transfer plasmid encoding a U6 promoter expressing a spyCas9 sgRNA (no spacer, BsmBI cutsites) and an EF1-a promoter expressing mNeonGreenDepositorInsertsspyCas9 sgRNA-BsmBI-Destination
mNeon
UseCRISPR and LentiviralExpressionMammalianPromoterEF1-a and U6Available SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only