We narrowed to 14,473 results for: cas9
-
Plasmid#74491PurposeHuman codon optimized plasmid to express arC9 t2a mCherry w/2xNLS and a sgRNADepositorInsertarC9
Tagst2a mCherryExpressionMammalianAvailable SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
-
pAEF5
Plasmid#136305PurposePlasmid encoding the Cas9 gene and a gRNA expression cassette allowing to clone a single or multiple gRNAs for DSBs induction in yeast. Constructed by Aubin FleissDepositorTypeEmpty backboneUseCRISPRAvailable SinceFeb. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRGEB34
Plasmid#158152PurposeConstruction of inPTG-Cas9 plasmids with a truncated 5'-UTR intron for plant genome editingDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGTag Hygro EGFP nLAP +0
Plasmid#194305PurposeCRISPR/Cas9-mediated generic protein taggingDepositorInsertHygro-P2A-nLAP(EGFP)
UseBacterial cloning vectorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
JME4393
Plasmid#129657PurposeLYS5ex_CrisprCas9-yl_RFP: CAS9 vector with LYS5ex marker for gRNA cloning using GoldenGateDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBC2102-reci
Plasmid#117171PurposeU6-sgRNA-EFS-Cas9-T2A-mCherry-P2A-Hygro; wtCas9 without NLSDepositorInsertreci_wtCas9 without NLS
UseLentiviralPromoterU6 PromoterAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAPIC-soma-AcrIIA4
Plasmid#250802PurposeDrosophila transgenic vector: To make tub-AcrIIA4 with piRNA targeting sequence in the 3'UTR; to suppress Cas9 activity in somatic tissues but not in the germlineDepositorInsertAcrIIA4
ExpressionInsectAvailable SinceApril 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ166-TREX2-N
Plasmid#244022PurposeGateway entry plasmid (attL1& attR5) expressing TREX2 exonuclease fused to the N-terminus of zSpCas9, connected by a flexible XTEN linker, without promoterDepositorInsertCas9
UseCRISPRTagsTREX2Available SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQ166-AtEXO1B-N
Plasmid#244023PurposeGateway entry plasmid (attL1& attR5) expressing AtEXO1B exonuclease fused to the N-terminus of zSpCas9, connected by a flexible XTEN linker, without promoterDepositorInsertCas9
UseCRISPRTagsAtEXO1BAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCPH3.3-GS3
Plasmid#204764PurposeExpression of Cas9 and human H3.3DepositorInsertH3.3
ExpressionMammalianAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGTag Hygro BFP nLAP +0
Plasmid#194317PurposeCRISPR/Cas9-mediated generic protein taggingDepositorInsertHygro-P2A-nLAP(BFP)
UseBacterial cloning vectorAvailable SinceSept. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGTag Hygro BFP nLAP -1
Plasmid#194324PurposeCRISPR/Cas9-mediated generic protein taggingDepositorInsertHygro-P2A-nLAP(BFP)
UseBacterial cloning vectorAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGTag Hygro BFP nLAP -0
Plasmid#194323PurposeCRISPR/Cas9-mediated generic protein taggingDepositorInsertHygro-P2A-nLAP(BFP)
UseBacterial cloning vectorAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGTag Hygro BFP nLAP -2
Plasmid#194325PurposeCRISPR/Cas9-mediated generic protein taggingDepositorInsertHygro-P2A-nLAP(BFP)
UseBacterial cloning vectorAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGTag Hygro BFP nLAP +1
Plasmid#194318PurposeCRISPR/Cas9-mediated generic protein taggingDepositorInsertHygro-P2A-nLAP(BFP)
UseBacterial cloning vectorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGTag Hygro BFP nLAP +2
Plasmid#194319PurposeCRISPR/Cas9-mediated generic protein taggingDepositorInsertHygro-P2A-nLAP(BFP)
UseBacterial cloning vectorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
RPL13A_PQR_mScarlet_NOL_LoxP_PQR_zeo_PQR_MCS_RPL13A-3'UTR
Plasmid#165043PurposeRepair template for CAS9 complex genome editingDepositorInsertRPL13A (RPL13A Human)
ExpressionBacterialAvailable SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
JME5000
Plasmid#129661PurposeEYK1ex_CrisprCas9-yl_RFP: CAS9 vector with EYK1ex marker for gRNA cloning using GoldenGateDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSPneoSagRNAH
Plasmid#123265PurposeExpresses gRNA of Staphylococcus aureus Cas9 (SaCas9) in LeishmaniaDepositorTypeEmpty backboneUseCRISPR; Leishmania expressionAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNeoSagRNAH
Plasmid#123266PurposeExpresses gRNA of Staphylococcus aureus Cas9 (SaCas9) in LeishmaniaDepositorTypeEmpty backboneUseCRISPR; Leishmania expressionAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pRR2
Plasmid#166097PurposeGal inducible expression of dCas9-FokIDepositorInsertdCas9-FokI
UseCRISPRExpressionYeastMutationspCas9-D10A, H840APromoterGal-inducibleAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMK
Plasmid#62818PurposeBacterial constitutive S. pyogenes Cas9 expression plasmidDepositorInsertCas9
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceMarch 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pITI1
Plasmid#166094PurposeGal inducible expression of dCas9-FokIDepositorInsertdCas9-FokI
UseCRISPRExpressionYeastMutationspCas9-D10A, H840APromoterGal-inducibleAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-Sa-TdTom. Reporter
Plasmid#99652PurposeRed fluorescent reporter that can be activated by dSa Cas9 activator indicating activityDepositorInsertRFP
ExpressionMammalianMutationdead Cas9Available SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDIV1068
Plasmid#247976PurposeCRISPR-Cas9 vector containing a 20 nt protospacer sequence to restore nkuA in Aspergillus nidulans. argB markerDepositorInsertCas9-AMA1-nkuA-gRNA-argB-Ori-AmpR
UseCRISPRMutationnoneAvailable SinceMarch 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
-
Lenti sgRNA NGFR GFP out of frame
Plasmid#155282PurposeLentiviral plasmid for sgRNA, NGFR marker, editing detected with GFP, used with 155280DepositorInsertGFP out of frame IRES NGFR
Available SinceSept. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDIV073
Plasmid#247962PurposeCRISPR-Cas9 vector containing a 20 nt protospacer sequence to target the uidA gene in the DIVERSIFY gene landing platform. pyrG markerDepositorInsertCas9-AMA1-uidA-gRNA-pyrG-Ori-AmpR
UseCRISPRMutationnoneAvailable SinceMarch 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDIV1067
Plasmid#247975PurposeCRISPR-Cas9 vector containing a 20 nt protospacer sequence to restore nkuA in Aspergillus nidulans. pyrG markerDepositorInsertCas9-AMA1-nkuA-gRNA-pyrG-Ori-AmpR
UseCRISPRMutationnoneAvailable SinceMarch 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDP082
Plasmid#103875PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Kluyveromyces marxianusDepositorInsertHH-gRNA-HDV targetting ADE2 in Kluyveromyces marxianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDP025
Plasmid#103874PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Kluyveromyces lactisDepositorInsertHH-gRNA-HDV targetting ADE2 in Kluyveromyces lactis
UseCRISPRExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDP002
Plasmid#103872PurposeBroad-host-range Cas9/gRNA co-expression backbone plasmid (no gRNA)DepositorInsertshph
Spcas9 D147Y P411T
UseCRISPRTagsNLSExpressionYeastMutationD147Y P411TPromoterArxula adeninivorans TEF1 and Ashbya gossypii (Er…Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDP013
Plasmid#103873PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Ogataea (para)polymorphaDepositorInsertHH-gRNA-HDV targetting ADE2 in Ogataea (para)polymorpha
UseCRISPRExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-CASANOVA
Plasmid#113036PurposeAAV vector for CASANOVA (AcrIIA4-LOV2 hybrid) expression in mammalian cells; enables optogenetic control of SpyCas9DepositorInsertCASANOVA (for CRISPR/Cas9 activity switching via a novel optogenetic variant of AcrIIA4)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-PE iSM_PPL2
Plasmid#235996PurposeExpresses iSM_PPL2 prime editor and pegRNA in mammalian cellsDepositorInsertiSM_PPL2_H840A-PE2-MMLV-RT(dBB)-P2A-PAC_dTK(dBB)
UseCRISPR and Synthetic Biology; Piggybac transposonTagsbpSV40 NLSExpressionMammalianMutationreplacement of 5 amino acids of Smac-Cas9 PL2 wit…Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only