We narrowed to 14,473 results for: cas9
-
Plasmid#204763PurposeExpression of Cas9 and human H3.2DepositorInsertH3.2 (HIST2H3PS2 Human)
ExpressionMammalianAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCPH2A.L-GS3
Plasmid#204756PurposeExpression of Cas9 and human H2A.LDepositorInsertH2AL3 (H2AC6 Human)
ExpressionMammalianAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-CMV152
Plasmid#179916PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting cytomegaloviral promoter site 152.DepositorInsertCMV promoter sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-CMV51
Plasmid#179915PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting cytomegaloviral promoter site 51.DepositorInsertCMV promoter sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-CMV162
Plasmid#179917PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting cytomegaloviral promoter site 162.DepositorInsertCMV promoter sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-mGreenLantern332
Plasmid#179914PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting mGreenLantern fluorescent protein site 332.DepositorInsertmGreenLantern sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag VP64 gRNA17 (FWA)
Plasmid#120250PurposeCRISPR-Cas9 SunTag system to target VP64 to the FWA locus with a single guide RNADepositorInsertg17_U6_NOS_NLS_GB1_NLS_linker_VP64_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJB172
Plasmid#86992PurposeCRISPR/Cas9 in fission yeast using fluoride selection and targetting pil1DepositorInsertgRNA targeting pil1
ExpressionYeastAvailable SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHU6_gRNA_Ch10-for2
Plasmid#81209Purposefor targeting Ch10 psuedo gix site in PCDH15 gene (five base pairs from the cas9 site and 3' of gix site)DepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-LoxP
Plasmid#127098PurposeLentiCRISPR v2 was modified into an all-in-one dox inducible system.DepositorInsertCas9-2A-eGFP
UseLentiviralPromoterU6Available SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
UC20m
Plasmid#121040PurposeMoClo golden gate assembly DE part for gN2 gRNA (guide RNA for S. pyogenes Cas9; sequence designed with NUPACK for stable tracrRNA structure and open targeting region).DepositorInsertgN2 Cas9 gRNA UC part
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSC49
Plasmid#104823PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma17g11235 (Dcl4a). Also expresses Cas9 from AtUBQ10 promoter.DepositorInsertGlyma17g11235
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDIV1064
Plasmid#247972PurposeCRISPR-Cas9 vector containing two 20 nt protospacer sequences to target the gene wA in Aspergillus nidulans. pyrG markerDepositorInsertCas9-AMA1-wA-gRNA 1 & 2-pyrG-Ori-AmpR
UseCRISPRMutationnoneAvailable SinceMarch 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMG005_mNeonGreen_P2A
Plasmid#237215PurposeFluorescent reporter codon optimized for Dictyostelid speciesDepositorInsertmNeonGreen-P2A
UseCloningTags3xFLAG-tag, HA-tag, SV40-NLS, and nuleoplasmin NL…Available SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMG008_mCherry_P2A
Plasmid#237216PurposeFluorescent reporter codon optimized for Dictyostelid speciesDepositorInsertmCherry-P2A
UseCloningTags3xFLAG-tag, HA-tag, SV40-NLS, and nuleoplasmin NL…Available SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
CRISPR plasmid
Plasmid#236553PurposeEncodes Cas9 and two guideRNAs, one to cut the genome downstream of HSPA5 (BiP/GRP78) and one to linearize the DONOR plasmid.DepositorInsertCas9
ExpressionMammalianAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSC38
Plasmid#104812PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr3g107390 (MtRdr6). Also expresses Cas9 from AtUBQ10 promoter.DepositorInsertMedtr3g107390
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC37
Plasmid#104811PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr3g107390 (MtRdr6). Also expresses Cas9 from Gmubi promoterDepositorInsertMedtr3g107390
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330 Mouse 3' Hp1a gRNA
Plasmid#127898PurposeWT Cas9 Vector targeting the 3' end of the mouse Hp1a geneDepositorInsertgRNA/Cas9
UseCRISPRAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330 Mouse 5' Npm1 gRNA
Plasmid#127900PurposeWT Cas9 Vector targeting the 5' end of the mouse Npm1 geneDepositorInsertgRNA/Cas9
UseCRISPRAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
NM-01
Plasmid#69799PurposeBacterial expression of Cas9 with His, MBP, and Strep tagsDepositorInsertCas9
TagsHIS, MBP, and StrepIIExpressionBacterialMutationAspartate 10 to Alanine (D10A) and Histidine 840 …Available SinceOct. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDIV069
Plasmid#247966PurposeCRISPR-Cas9 vector containing a 20 nt protospacer sequence to target the IS1 locus where the DIVERSIFY gene landing platform is integrated in Aspergillus nidulans. pyrG markerDepositorInsertCas9-AMA1-IS1-gRNA-pyrG-ori-AmpR
UseCRISPRMutationnoneAvailable SinceMarch 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pXZ13lacZalphaKanR
Plasmid#160230PurposeLike pXZ13lacZalpha, but adds second level of selection with Kanamycin resistance.DepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterlacAvailable SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
UC16m
Plasmid#121038PurposeMoClo golden gate assembly DE part for gQi gRNA (guide RNA for S. pyogenes Cas9; sequence from DOI: 10.1016/j.cell.2013.02.022). Please see Supplemental Documents for annotated Genbank file.DepositorInsertgQi Cas9 gRNA UC part
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
UC17m
Plasmid#121039PurposeMoClo golden gate assembly DE part for gV1 gRNA (guide RNA for S. pyogenes Cas9; sequence from doi: [10.15252/msb.20145735]). Please see Supplemental Documents for annotated Genbank file.DepositorInsertgV1 Cas9 gRNA UC part
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
C114m
Plasmid#121013PurposeMoClo golden gate assembly CD part for Cas9 (S. pyogenes gRNA-targeted endonuclease Cas9, with bbsI cut sites removed synonymously). Please see Supplemental Documents for annotated Genbank file.DepositorInsertdCas9 with no bbsI or BsaI sites
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2
Plasmid#52961PurposeReplaces original lentiCRISPRv1 (Addgene Plasmid 49535) and produces ~10-fold higher titer virus. 3rd generation lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
UseCRISPR and LentiviralTagsFLAGExpressionMammalianPromoterEFS-NSAvailable SinceMay 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pXPR_011
Plasmid#59702PurposeThis lentiviral vector can be used to assay Cas9 activity.DepositorInsertEGFP sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceSept. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJMR19-ADE2
Plasmid#254119PurposeCandidozyma auris optimized vector expressing Cas9 and ADE2 targeting guide cassetteDepositorInsertCandidozyma auris ADE2 target sequence
UseCRISPRExpressionYeastAvailable SinceApril 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag NtDRMcd nog
Plasmid#115488PurposeCRISPR-Cas9 SunTag system to target NtDRMcd to specific loci of interest (nog=no guide)DepositorInsertNOS_NLS_GB1_NLS_linker_DRMcd_linker sfGFP_scFv_UBQ10_Insulator_ UBQ10_Ω dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCasPA
Plasmid#113347PurposeBacterial expression of Cas9 nuclease and λ-Red system in Pseudomonas aeruginosaDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCasAb-apr
Plasmid#121998PurposeBacterial expression of Cas9 nuclease and RecAb recombination system in Acinetobacter baumanniiDepositorTypeEmpty backboneUseCRISPRExpressionBacterialAvailable SinceSept. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAGM55261
Plasmid#153210PurposeLevel 2 cloning vector for a single guide RNA, already contains Cas9, Bar selection cassette and FAST markerDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTPH405c
Plasmid#185726PurposeDirected evolution of Cas9 adenine base editors with altered PAM compatibilityDepositorInsertgIII(N)-NpuN-NpuC-gIII(C) single PAM linker
UseCRISPRExpressionBacterialAvailable SinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
L40C-CRISPR.EFS.PAC
Plasmid#89393PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA (hU6), PAC (Puromycin resistance) coexpression, EFS Promoter drivenDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDM026
Plasmid#216808PurposeVector for Aspergillus CRISPR-Cas9 genetic engineering with Golden Gate cloning drop-out cassette for protospacer insertion and pyrG selectable marker.DepositorTypeEmpty backboneUseCRISPR; Fungal expressionExpressionBacterialAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
iSpyMac
Plasmid#155014PurposeExpresses the codon-optimized, engineered iSpyMac Cas9 nuclease in mammalian cellsDepositorInsertiSpyMac
ExpressionMammalianMutationPID grafted onto SpyCas9 N-terminal domain, R221K…PromoterEF1ɑAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAGM37443
Plasmid#153218PurposeLevel 2 binary vector for plant transformation; for cloning Cas9 and guide RNAs; single copy in Agrobacterium.DepositorTypeEmpty backboneExpressionPlantAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only