We narrowed to 81,735 results for: TRI
-
Plasmid#78761PurposeTo overexpress p14ARF in Mammalian CellsDepositorAvailable SinceJune 9, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pCS2+ cMyc Dam_f_GFPoNLS
Plasmid#85820PurposeiDamID plasmid. To express transiently the c-Myc-tagged , L122A-mutant E. coli Dam adenine methyltransferase fused to the nuclear-localized mmGFP via flexylinker.DepositorInsertcMyc Dam_f_GFPoNLS
TagscMyc and oNLS (optimized nuclear localization sig…ExpressionBacterial, Insect, Mammalia…MutationL122A.Available SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA1-Bystin
Plasmid#11869DepositorInsertBystin (BYSL Human)
ExpressionMammalianAvailable SinceSept. 1, 2006AvailabilityAcademic Institutions and Nonprofits only -
139H2_LC
Plasmid#206202PurposeFor recombinant expression of the light chain of the Mouse anti-MUC1 antibody 139H2 in mammalian cells.DepositorAvailable SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT JunD-HA
Plasmid#58498PurposeGateway entry vector for an inducible HA-tagged mouse JunDDepositorAvailable SinceSept. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBS-Squ:mCherry
Plasmid#20163DepositorInsertspaghetti squash (squ, myosin II RLC) 5' UTR and ORF fused to mCherry followed by squ 3' UTR (sqh Fly)
ExpressionBacterialAvailable SinceApril 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
pMXs-hs-3xHA-deltaRING-LIN-41
Plasmid#52718Purposeretroviral expression of human LIN-41 / TRIM71 containing a RING domain deletion and 3 N-terminal HA tagsDepositorInsertLIN-41 (TRIM71 Human)
UseRetroviralTags3xHAExpressionMammalianMutationdeleted amino acids 12-91Available SinceJune 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-puro-AS9 (Mito MTS)-Delta N67-mMCL1
Plasmid#45822DepositorInsertAS9(Mito MTS)-Delta N67-mMCL1
ExpressionMammalianMutationATP Synthase subunit 9 is used as a Mito Targetin…Available SinceJuly 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
HOXB7 (human) pCMV
Plasmid#8539DepositorInsertHOXB7 (HOXB7 Human)
TagsFLAGExpressionMammalianMutationstarts at AA#1 preceeded by FLAG and Ser-Arg-Ile…Available SinceMay 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C3-PLK4-S305E-3xFLAG
Plasmid#69840PurposeThis plasmid encodes PLK4 isoform 1 carrying an S305E mutation with an N-terminal EGFP tag and C-terminal 3xFLAG tagDepositorAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23_TSS1
Plasmid#210633PurposeLuciferase experiment for TAL1 TSS1DepositorInsertTAL1 TSS1 (TAL1 Human)
ExpressionMammalianAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23_TSS2
Plasmid#210634PurposeLuciferase experiment for TAL1 TSS2DepositorInsertTAL1 TSS2 (TAL1 Human)
ExpressionMammalianAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23_TSS4
Plasmid#210635PurposeLuciferase experiment for TAL1 TSS4DepositorInsertTAL1 TSS4 (TAL1 Human)
ExpressionMammalianAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23_TSS5
Plasmid#210636PurposeLuciferase experiment for TAL1 TSS5DepositorInsertTAL1 TSS5 (TAL1 Human)
ExpressionMammalianAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
FH1-PNGT#1-mCherry
Plasmid#164098PurposeFluorescent reporter for genetic tracing of proneural Glioblastoma cell-state.DepositorInsertPNGT#1-mCherry
UseLentiviral and Synthetic BiologyAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
HOXB4 (human) FLAG MSCV
Plasmid#8528DepositorInsertHOXB4 (HOXB4 Human)
UseRetroviralTagsFLAGExpressionMammalianMutationMissing N-terminal 14 amino acids; improved Ribos…Available SinceMay 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C3-PLK4-S285A/T289A-3xFLAG
Plasmid#69841PurposeThis plasmid encodes PLK4 isoform 1 carrying S285A/T289A mutations with an N-terminal EGFP tag and C-terminal 3xFLAG tagDepositorInsertPLK4 (PLK4 Human)
Tags3xFLAG tag and EGFPExpressionMammalianMutationS285A/T289APromoterCMVAvailable SinceDec. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Cerulean3-Cerulean3-FLARE-CKAR
Plasmid#123346PurposeCyan-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase C activity.DepositorInsertCerulean3-Cerulean3-FLARE-CKAR
Tags6xHIS, Cerulean3, T7 tag (gene 10 leader), and Xp…ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMT-flk1-cytoBirA-2A-mCherry_Ras
Plasmid#80056PurposeFlk1/Kdrl promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
Tags3x HAExpressionBacterialPromoterflk1Available SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2-VN
Plasmid#135485PurposeMammalian expression of VN-fused and myc-tagged HLA-A*02:01DepositorInsertHLA-A*02:01 (HLA-A Human)
TagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
p1193-scAAV-U6-sgRNA_Nme2Cas9_Rosa26-CB-PI-AcrIIC3Nme_FLAG_NLS-3XmiR122BS
Plasmid#129531PurposeSelf-complementary AAV vector expressing Nme2Cas9 sgRNA targeting Rosa26 and AcrIIC3Nme with 3x miR-122 binding sites in 3' UTRDepositorInsertscodon-optimized AcrIIC3Nme
sgRNA_Rosa26
UseAAVTagsFLAG/NLSPromoterU6 and cytomegalovirus-enhancer chicken β-actin p…Available SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEMS2044
Plasmid#79652PurposessAAV genome with Ple255 (PAX6 MiniPromoter) driving an emerald GFP (EmGFP) reporter. Contains WPREDepositorInsertssAAV Ple255-EmGFP WPRE
UseAAVPromoterPAX6 HS234Z EnhancerAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-GFP-GFP-FLARE-AKAR
Plasmid#123332PurposeGreen-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity.DepositorInsertGFP-GFP-FLARE-AKAR
Tags6xHIS, EGFP, T7 tag (gene 10 leader), and Xpress …ExpressionMammalianPromoterCMVAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCS3-MT-BX/ARF1-64
Plasmid#78762PurposeTo overexpress ARF1-64 in Mammalian CellsDepositorAvailable SinceJune 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCS3-MT-BX/ARF65-132
Plasmid#78763PurposeTo overexpress ARF65-132 in Mammalian CellsDepositorAvailable SinceJune 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-1-INTS3-N
Plasmid#128416PurposeExpress INTS3 N-termini (1-513 aa) in E. coli with a GST tag (N-terminal)DepositorInsertINTS3 (INTS3 Human)
TagsGSTExpressionBacterialMutationN-terminal region (1–513 aa)Promotertac promoterAvailable SinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-SwitchON-sgCh2-2
Plasmid#199637PurposeTamoxifen-inducible expression of sgRNA control targeting intergenic regionDepositorInsertN/A
UseLentiviralAvailable SinceJune 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
HOXB4 (human) HA-TAT-tag pET
Plasmid#8526DepositorInsertHOXB4 (HOXB4 Human)
TagsHAExpressionBacterialMutationreplace T7 and HIS tags of pET with an HA tag;Available SinceMay 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
HH06-LP Clone 6 heavy chain
Plasmid#192176PurposeClone 6 heavy chain (HH06)DepositorInsertClone 6 heavy chain (HH06)
ExpressionMammalianMutationNAAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
p221- purVSG117UTR
Plasmid#59732PurposeInserts a puromycin resistance gene and a VSG117 gene into the VSG221 expression site of T.brucei downstream of the expression site promoter.DepositorInsertVSG117 flanked upstream and downstream by sequences homologous to the VSG221 expression site
UseFor homologous recombination into vsg221 expressi…Available SinceAug. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ oDam_f_GFPoNLS
Plasmid#85819PurposeiDamID plasmid. To express transiently the optimized E. coli Dam adenine methyltransferase fused to the nuclear-localized mmGFP via flexylinker.DepositorInsertoDam_f_GFPoNLS
TagsoNLS (optimized nuclear localization signal) C te…ExpressionBacterial, Insect, Mammalia…MutationL122A. Codon optimization compatible to work in M…Available SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGBT9-Hook2
Plasmid#198524PurposeExpression of GAL4 DNA-binding domain (BD)-Hook2 fusion protein in yeast (yeast two-hybrid assays)DepositorInsertHook2 (HOOK2 Human)
TagsGAL4-DNA binding domain fragmentExpressionYeastMutationHis488Gln substitutionPromoterADH1Available SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBS-Squ5'3'
Plasmid#20165DepositorInsertspaghetti squash (squ, myosin II RLC) 5' UTR, ORF (without stop codon) and 3' UTR with multiple cloning site downstream (sqh Fly)
ExpressionBacterialAvailable SinceApril 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
pPKm-245
Plasmid#90503PurposeExpresses HO1, PCYA, FD and FNR, required for PCB synthesis. pSIN - EF-1alpha - MTS - tHO1 - P2A - MTS - tPCYA - P2A - MTS - tFD - P2A - MTS - tFNRDepositorInsertmito-tHO1, mito-tPCYA, mito-tFD, mito-tFNR
UseLentiviralAvailable SinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPKm-244
Plasmid#90502PurposeExpresses HO1, PCYA, FD and FNR, required for PCB synthesis. pSIN - EF-1alpha - MTS - tHO1 - P2A - MTS - tPCYA - IRES - MTS - tFD - P2A - MTS - tFNRDepositorInsertmito-tHO1, mito-tPCYA, mito-tFD, mito-tFNR
UseLentiviralAvailable SinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmiR-96 cluster promoter
Plasmid#62517PurposemicroRNA 183-96-182 cluster promoter luciferase plasmidDepositorInsertpromoter of microRNA-183-96-182 cluster
TagsRenSP (optimized renilla luciferase gene)ExpressionMammalianAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pQC hKGA.wt V5-His IRES G418
Plasmid#110390Purposeγ-Retroviral transfer vector for expressing glutminase isoform KGA (wild type), C-terminal V5-6xHis tags, IRES-driven Geneticin selection.DepositorInsertKGA glutaminase (GLS Human)
UseRetroviralTags6xHis and V5ExpressionMammalianPromoterCMVAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO.1 PURO shId2 #2
Plasmid#83090PurposeLentiviral shRNA vector for inducible knockdown of mouse Id2DepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE hygro MEN1 L22R
Plasmid#11021DepositorAvailable SinceDec. 2, 2005AvailabilityAcademic Institutions and Nonprofits only -
pPN098
Plasmid#91625PurposeExpress sgRNA targeting human HCN1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN099
Plasmid#91626PurposeExpress sgRNA targeting human HCN1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgCCR5
Plasmid#83930PurposeLentiviral vector expressing an sgRNA targeting CCR5 NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgCCR5
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPKm-112
Plasmid#90494PurposepcDNA3 - pCMV - MTAD - PIF3, expresses Phytochrome interacting factor 3 (PIF3) and minimal transactivation domain (MTAD), under CMV promoterDepositorInsertMTAD-PIF3
ExpressionMammalianAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFLAG-4S Tetherin
Plasmid#41073DepositorInsertTetherin (BST2 Human)
TagsFLAGExpressionMammalianMutationS74, S84, 137S, and 144SPromoterCMVAvailable SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Venus-Venus-FLARE-AKAR
Plasmid#123331PurposeYellow-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity.DepositorInsertVenus-Venus-FLARE-AKAR
Tags6xHIS, T7 tag (gene 10 leader), Venus, and Xpress…ExpressionMammalianPromoterCMVAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_FOXM1_iso1
Plasmid#135734PurposeDonor vector for 3' FLAG tag of human FOXM1_iso1DepositorAvailable SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Cerulean3-Cerulean3-FLARE-EKAR-EV
Plasmid#123342PurposeCyan-fluorescent homoFRET/anisotropy-based biosensor for monitoring ERK activity.DepositorInsertCerulean3-Cerulean3-FLARE-EKAR-EV
Tags6xHIS, Cerulean3, T7 tag (gene 10 leader), and Xp…ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEMS2049
Plasmid#79657PurposessAAV genome with Ple260 (PAX6 MiniPromoter) driving an emerald GFP (EmGFP) reporter. Contains WPREDepositorInsertssAAV Ple260-EmGFP WPRE
UseAAVPromoterPAX6 Retinal EnhancerAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFLAG-137.144S Tetherin
Plasmid#41072DepositorAvailable SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only