We narrowed to 33,255 results for: IND
-
Plasmid#107267PurposemCherry-eDHFR-Cdc42Q61L in pIVT vector for in vitro transcription. Note that Cdc42 in this plasmid keeps its CAAX domain.DepositorUseTagsmCherryExpressionMammalianMutationPromoterT7Available SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pMTS_mScarlet-H_N1
Plasmid#85058PurposeIn vivo visualization of the mitochondria (can be used for colocalization studies)DepositorAvailable SinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
ET8-GPIba-6His
Plasmid#102878PurposeWild type human platelet membrane protein GPIb alpha (1-290aa) with 6Histag at the C-terminusDepositorInsertHuman platelet membrane protein GPIb alpha 1-290aa (GP1BA Human)
UseTags6xHis tagExpressionMammalianMutationPromoterCMV promoterAvailable SinceNov. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-tetO-Id2
Plasmid#70764PurposeLentiviral plasmid for tetracycline/doxycycline dependent expression of murine Id2DepositorInsertinhibitor of DNA binding 2 (Id2 Mouse)
UseLentiviralTagsExpressionMammalianMutationPromotertetOAvailable SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
MLM3720
Plasmid#49944PurposeExpresses a mutant TALE-TET1CD (inactive catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene for use as a controlDepositorInsert3x FLAG Tet1CDmut RH-3 (RHOXF2 Human)
UseTALENTags3x FLAGExpressionMutationcatalytic domain of TET1 inactive (H1671Y and D16…PromoterEF1aAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
3019_pETcon-SARS-CoV-2-RBD_E484K
Plasmid#184404Purposeyeast surface display of the SARS-CoV-2 Eta variant RBDDepositorInsertSARS-CoV-2 Eta Spike receptor binding domain (RBD) (S SARS-CoV-2 virus)
UseTagsHA and c-MycExpressionYeastMutationE484KPromoterAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE3_mCh-SspB (pBS1144)
Plasmid#185326PurposeFor the mammalian expression of the human protein ApoE3 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE3
UseTagsExpressionMammalianMutationPromoterAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
T7pr-His6-MBP-TEV-dCas9-BirA*
Plasmid#159994PurposeBacterial expression of dCas9-BirA*DepositorInsertdCas9-BirA*
UseTags6X-His, MBP, 3X-FLAG, NLSExpressionBacterialMutationD10A, H840APromoterT7Available SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pESC-LEU-SopB
Plasmid#183670PurposeInducible Salmonella Typhimurium SopB for expression in yeastDepositorInsertsopB (sopB Salmonella enterica serovar Typhimurium)
UseTagsExpressionYeastMutationPromoterGAL1Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pESC-Leu-SopB(C460S)
Plasmid#183671PurposeInducible Salmonella Typhimurium SopB (catalytically inactive) for expression in yeastDepositorInsertsopB (sopB Salmonella enterica serovar Typhimurium)
UseTagsExpressionYeastMutationC460SPromoterGAL1Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
NLS-tdPCP-CIBN
Plasmid#183937PurposePCP tandem dimer binding to PP7 RNA stem loops coupled to optogenetic CIBN domain; bound by PHR upon blue light exposureDepositorInserttdPCP-CIBN (CIB1 Mustard Weed, Synthetic)
UseTagsNLSExpressionMammalianMutationnonePromoterCMV (TATA box removed)Available SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
JA740
Plasmid#49939PurposeExpresses a TALE-TET1FL (full length TET1) fusion protein engineered to bind a site in EGFP for use as a controlDepositorAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-1 AUP1 292-410
Plasmid#185331PurposeBacterial expression of AUP1 with GST fusion protein for binding assaysDepositorAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
MLM3762
Plasmid#49947PurposeExpresses a mutant TALE-TET1CD (inactive catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene for use as a controlDepositorInsert3x FLAG Tet1CDmut RH-4 (RHOXF2 Human)
UseTALENTags3x FLAGExpressionMutationcatalytic domain of TET1 inactive (H1671Y and D16…PromoterEF1aAvailable SinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1 ObLiGaRe Donor vector/EPB58
Plasmid#90016PurposeDonor vector for ObLiGaRe/ZFN mediated targeting to AAVS1 locusDepositorInsertMCS flanked by inverted ZFN binding sites (PPP1R12C Human)
UseTagsExpressionBacterialMutationPromoterAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMXs-hGLIS1GR
Plasmid#59312PurposeForced expression of human GLIS1GRDepositorInsertGLIS1 (GLIS1 Human)
UseRetroviralTagscGR - hormone binding domain of glucocorticoid re…ExpressionMammalianMutationPromoterAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
JA524
Plasmid#49938PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in EGFP for use as a controlDepositorAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
R619-M67-303: CMV51p> SARS-CoV-2 S-RBD(319-541)-His6
Plasmid#166018Purposemammalian expression of SARS-CoV-2 spike receptor-binding domain (RBD)DepositorAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTXB1-hMeCP2-R270X
Plasmid#48092PurposeBacterial expression of Mxe intein/chitin binding domain tagged MeCP2-R270XDepositorInsertMethyl-CpG Binding Protein 2 (Rett Syndrome) (MECP2 Human)
UseTagsExpressionBacterialMutationMxe intein/chitin binding domain tagged, expresse…PromoterAvailable SinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
ApoE2_mCh-SspB (pBS1142)
Plasmid#185324PurposeFor the mammalian expression of the human protein ApoE2 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE2
UseTagsExpressionMammalianMutationPromoterAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
3021_pETcon-SARS-CoV-2-RBD_K417N_E484K_N501Y
Plasmid#184406Purposeyeast surface display of the SARS-CoV-2 Beta variant RBDDepositorInsertSARS-CoV-2 Beta Spike receptor binding domain (RBD) (S SARS-CoV-2 virus)
UseTagsHA and c-MycExpressionYeastMutationK417N+E484K+N501YPromoterAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTXB1-hMeCP2-G273X
Plasmid#48093PurposeBacterial expression of Mxe intein/chitin binding domain tagged MeCP2-G273XDepositorInsertMethyl-CpG Binding Protein 2 (Rett Syndrome) (MECP2 Human)
UseTagsExpressionBacterialMutationMxe intein/chitin binding domain tagged, expresse…PromoterAvailable SinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestFLAGHA_RBPMS
Plasmid#59388PurposeDestination vector with RBPMS for stable cell line generationDepositorAvailable SinceFeb. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
Myc-Idax DBM
Plasmid#68554PurposeThis plasmid expresses full length IDAX containing a DNA binding mutation.DepositorInsertIDAX-DBM (Cxxc4 Mouse)
UseTagsMycExpressionMammalianMutationT162A, H164A and Q165A mutationsPromoterEF1aAvailable SinceOct. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDGB3_Omega1_Pnos:ER:lexABD:GAL4AD:T35s-OplexA:mini35S:phi31:Tnos (GB1677)
Plasmid#160641PurposeModule for estradiol-inducible exp of the PhiC31 integrase gene. Includes TU for constitutive exp of an estradiol-inducible transcription activator and TU for estradiol-inducible exp of PhiC31.DepositorInsertERLexABDGal4AD / PhiC31
UseSynthetic BiologyTagsExpressionPlantMutationBsaI and BsmBI sites removedPromoterPnosAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHR-mCherry-p2A-LIC1 G domain
Plasmid#74602Purposeexpresses LIC1 in mammalian cells; aa 1-389, untagged but cells indicate expression with diffuse mCherryDepositorInsertfull length human dynein light intermediate chain 1 amino acids 1-389 (DYNC1LI1 Human)
UseLentiviralTagsHA tagExpressionMammalianMutationPromoterSFFVAvailable SinceMay 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMCSF-R(dAB)-luc
Plasmid#12423DepositorInsertM-CSF receptor promoter fragment (CSF1 Human)
UseLuciferaseTagsExpressionMutationNo AML1 and C/EBP binding sites (delete bp -86 to…PromoterAvailable SinceDec. 15, 2006AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-1 p37 SHPmut
Plasmid#113503PurposeBacterial expression of GST-tagged p37 that is p97 binding deficient due to mutations in the SHP boxDepositorInsertp37 (Ubxn2b Mouse)
UseTagsGST-PreScission protease siteExpressionBacterialMutationF215A/E218A/QKL220-222AAAPromoterAvailable SinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-REX-GECO0.9
Plasmid#61249PurposeExpresses REX-GECO0.9 in neuronsDepositorInsertREX-GECO0.9
UseAAVTagsExpressionMammalianMutationSubstitutions relative to R-GECO1: P60R, V61W, R6…PromoterhSynAvailable SinceMarch 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-1 p37 deltaUBX
Plasmid#113504PurposeBacterial expression of GST-tagged p37 lacking the UBX domainDepositorInsertp37 (Ubxn2b Mouse)
UseTagsGST-PreScission protease siteExpressionBacterialMutationdelta 251-331 (stop codon behind AA250)PromoterAvailable SinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
Bxb1-GT-Dox-AIO-TetOn_ETV2_Down-Tandem
Plasmid#241393PurposeBxb1-GT donor plasmid with downstream tandem syntax for all-in-one doxycycline-inducible expression of ETV2DepositorInsertTRE-ETV2; rtTA-T2A-mTagBFP2 (ETV2 Human)
UseTagsNLSExpressionMammalianMutationPromoterTRE; CAGAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Frankenbody-HA-mScarlet3-tdP2A-Frankenbody-FLAG-mEGFP-IRESv4-HaloTag-tdMCP
Plasmid#241140PurposeExpresses Anti-FLAG frankenbody-mScarlet3, anti-FLAG frankenbody-mEGFP, and HaloTag-tdMCP to track mature and nascent HA and FLAG-tagged proteins and MS2-tagged mRNADepositorInsertsAnti-FLAG frankenbody
anti-FLAG frankenbody
tdMCP
UseTagsHaloTag, mEGFP, and mScarlet3ExpressionMammalianMutationPromoterCMVAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBI121::chitGFP5:AQ
Plasmid#240450PurposeExpression of indicator protein fusion (soluble modified GFP5 & Aequorin) for monitoring calcium concentrations in cell walls of higher plants. See Resource Information.DepositorInsertFusion of Chitinase signal, smGFP5, and Aequorin
UseTagsExpressionBacterial and PlantMutationGFP5 for expression plants (PMID 9122158); Solubl…PromoterCauliflower mosaic virus 35S promoter (GenBank AJ…Available SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-scFv-GCN4-sfGFP-tdP2A-Frankenbody-FLAG-mScarlet3-IRESv4-HaloTag-tdMCP
Plasmid#241141PurposeExpresses Anti-GCN4 scFv-sfGFP, anti-FLAG frankenbody-mEGFP, and HaloTag-tdMCP to track mature and nascent SunTag and FLAG-tagged proteins and MS2-tagged mRNADepositorInsertsAnti-GCN4 scFv
anti-FLAG frankenbody
tdMCP
UseTagsHaloTag, mEGFP, and sfGFPExpressionMammalianMutationPromoterCMVAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-MmCENPT-ASD2HFD-GFP
Plasmid#237430PurposeExpresses Mus musculus CENP-T with ancestral HFD (mouse:rat); tagged with GFP at C-term; made for in vitro transcription (T7 promoter)DepositorInsertMus musculus CENP-T with ancestral HFD (Cenpt Mouse)
UseTagsGFPExpressionMammalianMutationHFD (residues 413-503) swapped from mouse:rat anc…PromoterT7Available SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-MmCENPT-RpHFD-GFP
Plasmid#237428PurposeExpresses Mus musculus CENP-T with Rhabdomys pumilio HFD; tagged with GFP at C-term; made for in vitro transcription (T7 promoter)DepositorInsertMus musculus CENP-T with Rhabdomys pumilio HFD (Cenpt Mouse)
UseTagsGFPExpressionMammalianMutationHFD (residues 413-503) swapped from Rhabdomys pum…PromoterT7Available SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-MmCENPT-McHFD-GFP
Plasmid#237437PurposeExpresses Mus musculus CENP-T with Mus caroli HFD; tagged with GFP at C-term; made for in vitro transcription (T7 promoter)DepositorInsertMus musculus CENP-T with Mus caroli HFD (Cenpt Mouse)
UseTagsGFPExpressionMammalianMutationHFD (residues 413-503) swapped from Mus caroliPromoterT7Available SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-MmCENPT-RnHFD-GFP
Plasmid#237429PurposeExpresses Mus musculus CENP-T with Rattus norvegicus HFD; tagged with GFP at C-term; made for in vitro transcription (T7 promoter)DepositorInsertMus musculus CENP-T with Rattus norvegicus HFD (Cenpt Mouse)
UseTagsGFPExpressionMammalianMutationHFD (residues 413-503) swapped from Rattus norveg…PromoterT7Available SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-MmCENPT-MsHFD-GFP
Plasmid#237427PurposeExpresses Mus musculus CENP-T with Mus spretus HFD; tagged with GFP at C-term; made for in vitro transcription (T7 promoter)DepositorInsertMus musculus CENP-T with Mus spretus HFD (Cenpt Mouse)
UseTagsGFPExpressionMammalianMutationHFD (residues 413-503) swapped from Mus spretusPromoterT7Available SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only