We narrowed to 3,598 results for: cmv promoter
-
Plasmid#153485PurposeMammalian expression of FLAG-tagged Tapasin L18KDepositorAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pLPC-N-Myc-Flag-BirA-hPOT1-DeltaOB
Plasmid#166410Purposeexpress BirA-hPOT1 ĪOB in mammalian cellsDepositorAvailable SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
L1-neo-TET
Plasmid#51284Purposeexpresses codon optimized human L1 retrotransposon driven by CMV promoter and tagged with the self splicing intron neo cassetteDepositorInsertL1RE1 (L1RE1 Human)
TagsneoTET cassette with a tetrahymena self-splicing ā¦ExpressionMammalianPromoterCMVAvailable SinceMarch 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SypHer2-DAAO-NES
Plasmid#119184PurposeFusion of the pH-sensitive fluorescent biosensor SypHer2 with D-amino acid oxidase; excluded from nucleus. CMV promoter. Can serve as a pH control for HyPer.DepositorInsertSypHer2-DAAO-NES
UseAAVTagsNESExpressionMammalianPromoterCMVAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLC-Flag-CRBN-P2A-Hygro
Plasmid#124303PurposeLentiviral vector for expression of Flag tagged CRBN-P2A-Hygro casette from a CMV promoterDepositorAvailable SinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV sgRNA Expression Plasmid
Plasmid#174540PurposeContains restriction sites to clone in U6 promoter and sgRNA oligo. CMV-driven mCherry fluorescent marker.DepositorTypeEmpty backboneUseAAVTagsNoneExpressionMammalianPromoterCMVAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP_IRES_tdTomato
Plasmid#184046PurposeExpresses EGFP and tdTomato in mammalian cells under control of a CMV promoter by using an IRES sequenceDepositorInsertsEnhanced Green Fluorescent Protein
tdTomato
Internal Ribosome Entry Site
ExpressionMammalianPromoterCMVAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
TAK11
Plasmid#227095PurposeLuciferase reporter vector with HIV-1 TAR region cloned in pGL3 Basic vectorDepositorInsertCMV Promoter and HIV-1 TAR region
UseLuciferasePromoterCMVAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP_D2A_tdTomato
Plasmid#184045PurposeExpresses EGFP and tdTomato in mammalian cells under control of a CMV promoter by using a dual 2A peptide sequence (P2AT2A)DepositorInsertsEnhanced Green Fluorescent Protein
tdTomato
Dual 2A Peptide Sequence
ExpressionMammalianPromoterCMVAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLC-CUL4A WT-P2A-Puro
Plasmid#124304PurposeLentiviral vector for expression of wild-type CUL4A-P2A-Puro casette from a CMV promoterDepositorAvailable SinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLC-Flag-UBE2G1 sg2R-P2A-Hygro
Plasmid#124299PurposeLentiviral vector for expression of Flag tagged UBE2G1-P2A-Hygro casette from a CMV promoter. UBE2G1 cDNA contains silent mutations to disrupt a sgRNA binding site.DepositorInsertUBE2G1 (UBE2G1 Human)
UseLentiviralTagsFlagExpressionMammalianMutationseveral silent mutations to disrupt sgRNA targetiā¦PromoterCMVAvailable SinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
TAK8
Plasmid#227096PurposeLuciferase reporter vector with wild type 5' Element (MMTV) insertDepositorInsertCMV Promoter and R to 400bp Gag
UseLuciferasePromoterCMVAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCL1318
Plasmid#217960PurposeExpression of human H4 carrying three point mutations to disrupt binding with H3. Expression in mammalian cells driven by the CMV promoter.DepositorInsertHistone H4 (H4C1 Human)
TagseGFPExpressionMammalianMutationL63A, F66A, I71APromoterCMVAvailable SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCL1317
Plasmid#217959PurposeExpression of human H4 carrying a triple glycine insertion to disrupt folding with H3. Expression in mammalian cells driven by the CMV promoter.DepositorInsertHistone H4 (H4C1 Human)
TagseGFPExpressionMammalianMutationGGG insertion between V65 and F66PromoterCMVAvailable SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PGUS
Plasmid#207827PurposeFLAG-tagged PGUS driven by CMV promoterDepositorInsertPGUS
UseLentiviralTagsFLAGPromoterCMVAvailable SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLC-Flag-SENP8 sg2R-P2A-Hygro
Plasmid#124300PurposeLentiviral vector for expression of Flag tagged SENP8-P2A-Hygro casette from a CMV promoter. SENP8 cDNA contains silent mutations to disrupt a sgRNA binding site.DepositorInsertSENP8 (SENP8 Human)
UseLentiviralTagsFlagExpressionMammalianMutationseveral silent mutations to disrupt sgRNA targetiā¦PromoterCMVAvailable SinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pThom77.6
Plasmid#101637PurposeEncodes the fluorescent protein amFP486/K68M under a CMV promoter.DepositorInsertamFP486/K68M
ExpressionMammalianMutationK68MPromoterCMVAvailable SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-Halo-RNaseL
Plasmid#250856Purposelentiviral vector for expressing Halo-tagged RNase LDepositorAvailable SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only