We narrowed to 43,835 results for: Ina
-
Plasmid#170732PurposeThe plasmids contain inserts (ORFs) for expressing various members of the GlycoLipid Transfer Protein (GLTP) superfamily.DepositorAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA 3.1 mitoAURKA Lys162Met
Plasmid#157752PurposeExpression of kinase-dead AURKA K62M in mitochondriaDepositorInsertAURKA (AURKA Human)
ExpressionMammalianMutationAURKA K162M is a kinase-dead version of AURKAPromoterCMVAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRC/CMV-TYK2(delta)KL-VSV
Plasmid#139352PurposeExpression of TYK2 protein missing the kinase-like (pseudokinase) domainDepositorInsertTYK2 cDNA deleted of aa594-877 with a Tyr inserted after aa593 (TYK2 Human)
TagsVSVExpressionMammalianMutationV362F-deletion of aa 594-877PromoterCMVAvailable SinceJune 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCri-H6-TEV-GRAB
Plasmid#128498PurposeExpresses GRAB (from V34 to N181) (Streptococcus pyogenes serotype M1) in bacterial cells. With N-t H6x tag + TEV.DepositorInsertGRAB (Streptococcus pyogenes serotype M1) (grab Streptococcus pyogenes serotype M1)
TagsHis tag (6x)ExpressionBacterialPromoterT7Available SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCri-H6-TEV-GRAB-STREP
Plasmid#128499PurposeExpresses GRAB (from V34 to N181) in bacterial cells. With N-t H6x tag + TEV + protein + STREP(2x) tag.DepositorInsertGRAB (V34-N181) (grab Streptococcus pyogenes serotype M1)
TagsHis tag (6x) and Strep tag (2x)ExpressionBacterialPromoterT7Available SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMAL c2x Tral FL-15D
Plasmid#113010PurposeFor bacterial expression of MBP fusion of full-length Drosophila Tral with Phos-mimic mutationsDepositorInsertfull length tral (tral Fly)
ExpressionBacterialMutation15 PNG phosphorylation sites mutated to DAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
M3K5_HUMAN_D0
Plasmid#79710PurposeThis plasmid encodes the kinase domain of M3K5. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
E2AK2_HUMAN_D0
Plasmid#79712PurposeThis plasmid encodes the kinase domain of E2AK2. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
DMPK_HUMAN_D0
Plasmid#79717PurposeThis plasmid encodes the kinase domain of DMPK. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
KC1G1_HUMAN_D0
Plasmid#79691PurposeThis plasmid encodes the kinase domain of KC1G1. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
CSK22_HUMAN_D0
Plasmid#79704PurposeThis plasmid encodes the kinase domain of CSK22. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
Plxnb2(S)-AP-His
Plasmid#72003PurposeExpresses the N-terminal extracellular region of the PlexinB2 protein following proteolytic cleavage (ie, short), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-CD4-YEML-myc
Plasmid#58538PurposeExpresses human CD4 with the IFITM3 endocytosis motif (YEML) and a C-terminal myc tag in mammalian cells.DepositorInsertCD4 (CD4 Human)
TagsIFITM3 endocytosis Tyrosine-Glutamate-Methionine-…ExpressionMammalianMutationAdded C-terminal Tyrosine-Glutamate-Methionine-Le…Available SinceSept. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUC19_18GZG
Plasmid#117228Purposeshble flanked by an endogenous GAPDH promoter and terminator systemDepositorInsertshble
UseThraustochytrid expressionPromoterGAPDHAvailable SinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
DinoIII-bsr
Plasmid#155027PurposeDinoflagelate backbone for blasticidin S-resistance gene (bsr)DepositorInsertBlasticidin-S deaminase
ExpressionBacterialAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC:FCP:ShBle:FCP:EGFP
Plasmid#85987PurposeExpresses ShBle and EGFP with FCP promoters/terminators for F. cylindrus transformation.DepositorInsertsShBle
EGFP
PromoterFCPAvailable SinceJan. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CSF1R-V5/HIS
Plasmid#201984Purposeexpression of human CSF1R receptor tyrosine kinase in mammalian cellsDepositorInsertCSF1R receptor tyrosine kinase (CSF1R Human)
TagsV5, 6xHisExpressionMammalianPromoterCMVAvailable SinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-His6-ERK2-MEK1_R4F_coexpression
Plasmid#39212DepositorTagsHis6 and RBSExpressionBacterialMutationMEK1(R4F) = S218E, S222D and deletion of AA32-51PromoterT7 and T7 via RBSAvailable SinceJuly 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV_msfGFP-SEPT7
Plasmid#180315Purposemammalian expression of human SEPT7 fused to monomeric superfolder GFPDepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-DDR1-V5/HIS
Plasmid#201100Purposeexpression of human DDR1 receptor tyrosine kinase in mammalian cellsDepositorInserthuman DDR1 receptor tyrosine kinase, full length, wildtype (DDR1 Human)
TagsV5/HisExpressionMammalianPromoterCMVAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-FGFR2c-V5/HIS
Plasmid#201107Purposeexpression of human FGFR2 receptor tyrosine kinase in mammalian cellsDepositorInserthuman FGFR2 receptor tyrosine kinase, variant c, full length, wildtype (FGFR2 Human)
TagsV5/HisExpressionMammalianPromoterCMVAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_4x(U6 tRNA M15)_CMV NESPylRS(AF)
Plasmid#182652PurposeEncodes codon-optimized AF mutant of M. mazei pyrrolysine (Pyl) tRNA synthetase fused to a nuclear export signal (NESPylRSAF) & 4x M15 tRNACUA used for amber codon suppression in mammalian cellsDepositorInsertscodon-optimized Y306A/Y384F (AF) double mutant of Methanosarcina mazei-derived pyrrolysine (Pyl) tRNA synthetase
4xU6-tRNAM15
Tagsnuclear export signal (NES)ExpressionMammalianMutationY306A/Y384F (AF) double mutant of Methanosarcina …PromoterCMV and U6Available SinceMay 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAcGFP1-N1-Dsup-deltaC
Plasmid#90023PurposeTo express GFP-tagged Dsup lacking C-terminal region in mammalian cells transientlyDepositorInsertDsup
TagsAcGFP1ExpressionMammalianMutationDeletion of C-terminal regionPromoterCMVAvailable SinceAug. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28a-MH6-uvsY
Plasmid#163914PurposeExpresses uvsY for bacterial expression and affinity purificationDepositorAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a-MH6-Bsu
Plasmid#163911PurposeExpresses Bsu large fragment for affinity purificationDepositorInsertBsu polymerase
TagsHisExpressionBacterialPromoterT7 promoterAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs T3950D
Plasmid#83320PurposeDNA-PKcs T3950ADepositorInserthuman DNA-PKcs (PRKDC Human)
ExpressionMammalianMutationActivation loop phosphorylation site 3950 substit…Available SinceAug. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDY0310 TP901-1 Integrase
Plasmid#179110PurposeTP901-1 Integrase expression vectorDepositorInsertTP901-1 Integrase
UseCRISPRExpressionMammalianAvailable SinceFeb. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-ERBB3-V5/HIS
Plasmid#201104Purposeexpression of human ERBB3 receptor tyrosine kinase in mammalian cellsDepositorInserthuman ERBB3 receptor tyrosine kinase, full length, wildtype (ERBB3 Human)
TagsV5/HisExpressionMammalianPromoterCMVAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N3-EPAC1
Plasmid#113110PurposeHuman EPAC1 gene was fused in-frame and upstream from the enhanced YFP gene in pEYFP-N3 vector (Clonetech).DepositorAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMV Puro DEST p38KTRmCerulean3
Plasmid#59155PurposeLentiviral vector to express p38 KTR mCerulean3 under CMV promoter (With Puromycin Resistance)DepositorInsertp38 Kinase Translocation Reporter (MAPK14 Mouse, Human)
UseLentiviralTagsmCerulean3ExpressionMammalianPromoterCMVAvailable SinceSept. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTol2CG2-ubi:QFGal4-SV40pA
Plasmid#155119PurposeTol2 vector for ubiquitous expression of QFGal4. Contains cmlc2:mRFP-SV40pA transgenesis markerDepositorInsertubi:QFGal4 (ubb Zebrafish, Budding Yeast, Neurospora crassa)
UseZebrafish expressionPromoterubiquitin BAvailable SinceSept. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-FLT3-D835Y-V5/HIS
Plasmid#236007Purposeexpression of the D835Y kinase defective mutant variant of human FLT3 that is associated with Acute Myeloid Leukemia and Acute Lymphoblastic LeukemiaDepositorInserthuman FLT3-D835Y receptor tyrosine kinase, full length (FLT3 Human)
TagsV5/HisExpressionMammalianMutationD835Y substitutionPromoterCMVAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-Blast-DNTGFBR2-HA
Plasmid#130888PurposeExpresses dominant negative mutant human TGFBR2DepositorInsertTGFBR2 (TGFBR2 Human)
TagsHA-tagExpressionMammalianMutationDominant Negative receptor lacking cytosolic cata…PromoterCMVAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
SFFV-CEBPA-Brd 467
Plasmid#219368PurposeTranscription factor CEBPA with a specific barcode assigned.DepositorAvailable SinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
SFFV-HOXB3-Brd 256
Plasmid#219199PurposeTranscription factor HOXB3 with a specific barcode assigned.DepositorAvailable SinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
SFFV-MSANTD3-Brd 261
Plasmid#219203PurposeTranscription factor MSANTD3 with a specific barcode assigned.DepositorInsertMSANTD3 (C9orf30 Human)
UseLentiviralMutationCodon optimizedPromoterThe spleen focus-forming virus (SFFV) promoterAvailable SinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
SFFV-LMO2-Brd 97
Plasmid#219070PurposeTranscription factor LMO2 with a specific barcode assigned.DepositorAvailable SinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
SFFV-CREB5-Brd 100
Plasmid#219072PurposeTranscription factor CREB5 with a specific barcode assigned.DepositorAvailable SinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
SFFV-ARID3A-Brd 69
Plasmid#219047PurposeTranscription factor ARID3A with a specific barcode assigned.DepositorAvailable SinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only