We narrowed to 1,177 results for: POLI
-
Plasmid#226315PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with Y to A CsoS2 MR1-7
UseTagsExpressionBacterialMutationY300A, Y359A, Y420A, Y475A, Y534A, Y585A, Y644APromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB74
Plasmid#226314PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with Y to A CsoS2 MR1-5
UseTagsExpressionBacterialMutationY300A, Y359A, Y420A, Y475A, Y534APromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB73
Plasmid#226313PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with Y to A CsoS2 MR1-3
UseTagsExpressionBacterialMutationY300A, Y359A, Y420APromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB51
Plasmid#226308PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with V(T/S)G to AAA CsoS2 MR1
UseTagsExpressionBacterialMutationVTG273-275AAA, VTG284-286AAA, VTG295-297AAAPromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB48
Plasmid#226307PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with C to S CsoS2 MR1-6
UseTagsExpressionBacterialMutationC292S, C310S, C351S, C369S, C467S, C485S, C526S, …PromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB47
Plasmid#226306PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with C to S CsoS2 MR1-5
UseTagsExpressionBacterialMutationC292S, C310S, C351S, C369S, C467S, C485S, C526S, …PromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB46
Plasmid#226305PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with C to S CsoS2 MR1-4
UseTagsExpressionBacterialMutationC292S, C310S, C351S, C369S, C467S, C485SPromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB45
Plasmid#226304PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with C to S CsoS2 MR1-2
UseTagsExpressionBacterialMutationC292S, C310S, C351S, C369SPromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB53
Plasmid#226309PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with V(T/S)G to AAA CsoS2 MR1-3
UseTagsExpressionBacterialMutationVTG273-5AAA, VTG284-6AAA, VTG295-7AAA, VSG332-4AA…PromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
SLC39A14-GFP
Plasmid#104380PurposeExpresses SLC39A14/ZIP14 wild-type in mammalian cellsDepositorInsertSLC39A14 (SLC39A14 Human)
UseTagsGFPExpressionMammalianMutationPromoterCMVAvailable sinceDec. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJB50
Plasmid#226311PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with V(T/S)G to AAA CsoS2 MR1-7
UseTagsExpressionBacterialMutationVTG273-5AAA, VTG284-6AAA, VTG295-7AAA, VSG332-4AA…PromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB55
Plasmid#226310PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with V(T/S)G to AAA CsoS2 MR1-5
UseTagsExpressionBacterialMutationVTG273-5AAA, VTG284-6AAA, VTG295-7AAA, VSG332-4AA…PromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-AR Q48
Plasmid#86428PurposeFluorescent human androgen receptor (fused to EGFP) with expanded polyglutamine regionDepositorInsertAndrogen receptor (AR) (AR Human)
UseTagsEGFPExpressionMammalianMutationPoly-glutamine expansion, G130DPromoterCMVAvailable sinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-AR Q0
Plasmid#86427PurposeFluorescent human androgen receptor (fused to EGFP) with deleted polyglutamine regionDepositorInsertandrogen receptor (AR) (AR Human)
UseTagsEGFPExpressionMammalianMutationDeletion of the poly-glutamine expansionPromoterCMVAvailable sinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLQ10873
Plasmid#183961PurposeU6-SKSKSO(crRNA array)-CAG-hyperdCas12a-HA-miniVPRDepositorInsertsHyperdCas12a
poly-crRNA array targeting Sox2-Klf4-Oct4
UseCRISPRTagsHAExpressionMammalianMutationD832A, D156R, E292R, D235R, D350RPromoterCAG and U6Available sinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
FUW-C-prM-E-NS1
Plasmid#175281Purposelentiviral vector mediating bicistronic expression of the 4 genes of YFV-17D (C-prM-E-NS1) and EGFP.DepositorInsertC-prM-E-NS1 and EGFP (POLY Yellow fever virus strain 17D)
UseLentiviralTagsIRES EGFPExpressionMutationPromoterhuman ubiquitin CAvailable sinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-Syn-NS1
Plasmid#175276PurposeAAV vector mediating bicistronic expression of NS1 gene of YFV-17D and dTomato with NLSDepositorInsertNonstructural protein 1 (NS1) of YFV-17D; NLS-dTomato (POLY Yellow fever virus strain 17D)
UseAAVTagsNLS-dTomato (P2A cleavage)ExpressionMutationPromoterSynapsinAvailable sinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-NS1NF
Plasmid#175279PurposeAAV vector mediating inducible expression of the NS1 gene of YFV-17DDepositorInsertNS1 (POLY Yellow fever virus strain 17D)
UseAAVTagsExpressionMutationPromotertight TREAvailable sinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DIO-NS1
Plasmid#175273PurposeAAV vector mediating Cre-depenent expression of NS1 gene of YFV-17DDepositorInsertNonstructural protein 1 (NS1) of YFV-17D (POLY Yellow fever virus strain 17D)
UseAAVTagsExpressionMutationPromoterSynapsinAvailable sinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-NS1-dTomato
Plasmid#175278PurposeAAV vector mediating inducible bicistronic expression of NS1 gene of YFV-17D and dTomatoDepositorInsertNS1; dTomato (POLY Yellow fever virus strain 17D)
UseAAVTagsdTomato (from bidirectional promoter)ExpressionMutationPromoterbidirectional TRE promoterAvailable sinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-C-prM-E-NS1
Plasmid#175277PurposeAAV vector mediating inducible expression of 4 genes (the C-prM-E-NS1) of YFV-17DDepositorInsertC-prM-E-NS1 (POLY Yellow fever virus strain 17D)
UseAAVTagsExpressionMutationPromotertight TREAvailable sinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PARP1_D770A-mCherry
Plasmid#192260PurposeExpresses PARP1 D770A mutant in mammalian cells. Tagged with mCherry.DepositorInsertPARP1_D770A (PARP1 Human)
UseTagsmCherryExpressionMammalianMutationD770APromoterCMVAvailable sinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PARP1_R878A-mCherry
Plasmid#192261PurposeExpresses PARP1 R878A mutant in mammalian cells. Tagged with mCherry.DepositorInsertPARP1_R878A (PARP1 Human)
UseTagsmCherryExpressionMammalianMutationR878APromoterCMVAvailable sinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
TFORF1953
Plasmid#142897PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertPARP1 (PARP1 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNSA-FLUC
Plasmid#98143PurposeGateway compatible construct for N' terminal fusion or promoter driven firefly luciferase reporter, zeocin resistance cassetteDepositorTypeEmpty backboneUseAlgae, nannochloropsisTagsHAExpressionMutationPromoterAvailable sinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNOC-RLUC
Plasmid#98142PurposeGateway compatible construct for N' terminal fusion or promoter driven renilla luciferase reporter, hygromycin resistance cassetteDepositorTypeEmpty backboneUseAlgae, nannochloropsisTagsHAExpressionMutationPromoterAvailable sinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNOC-NLUC
Plasmid#98141PurposeGateway compatible construct for N' terminal fusion or promoter driven NanoLuciferase reporter, hygromycin resistance cassetteDepositorTypeEmpty backboneUseAlgae, nannochloropsisTagsHAExpressionMutationPromoterAvailable sinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNOC-FLUC
Plasmid#98140PurposeGateway compatible construct for N' terminal fusion or promoter driven firefly luciferase reporter, hygromycin resistance cassetteDepositorTypeEmpty backboneUseAlgae, nannochloropsisTagsHAExpressionMutationPromoterAvailable sinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNOC-stacked-GeNL
Plasmid#101002PurposeConstruct for fusion expression of GeNL reporter and neomycin/G418 resistance gene by a bidirectional promoterDepositorTypeEmpty backboneUseAlgae, nannochloropsisTagsExpressionMutationPromoterRibiAvailable sinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHnCB
Plasmid#52064Purposeexpresses nine genes from the H. neapolitanus carboxysome operon; IPTG-inducibleDepositorInsertCbbL, CbbS, CSOS2, CSOS3, CSOS4A, CSOS4B, CSOS1C, CSOS1A, CSOS1B
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP
Plasmid#235573PurposeDox-inducible expression of control superfolder (sf)GFP fused with scFVDepositorInsertsuperfolder (sf)fGFP
UseCRISPRTagsExpressionMutationPromoterAvailable sinceApril 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_dCas9-5xGCN4_Hygro
Plasmid#235572PurposeDox-inducible expression of dCas9-GCN4 & genomic integrationDepositorInsertdCas9-5xGCN4
UseCRISPRTagsExpressionMutationD10A; H840APromoterAvailable sinceApril 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNOC-stacked-GFP-aequorin
Plasmid#101011PurposeConstruct for expression of a calcium sensitive luciferase reporter, GFP-aequorin, and hygromycin resistance gene by a bidirectional promoterDepositorTypeEmpty backboneUseAlgae, nannochloropsisTagsExpressionMutationPromoterRibiAvailable sinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNOC-ARS-stacked-NeoR-mNeonGreen
Plasmid#101249PurposeConstruct for fusion expression of mNeonGreen reporter and G418 resistance gene by a bidirectional promoterDepositorTypeEmpty backboneUseAlgae, nannochloropsisTagsExpressionMutationPromoterRibiAvailable sinceMay 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNOC-stacked-aequorin
Plasmid#101010PurposeConstruct for expression of aequorin, calcium sensitive luciferase reporter and hygromycin resistance gene by a bidirectional promoterDepositorTypeEmpty backboneUseAlgae, nannochloropsisTagsExpressionMutationPromoterRibiAvailable sinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHnCBS1D
Plasmid#52065Purposeexpresses nine genes from the H. neapolitanus carboxysome operon and CSOS1D; IPTG-inducibleDepositorInsertCbbL, CbbS, CSOS2, CSOS3, CSOS4A, CSOS4B, CSOS1C, CSOS1A, CSOS1B, CSOS1D
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pet11a-ABLE
Plasmid#158627PurposeAmp resistant IPTG inducible 6xHis-TEV-ABLE protein for E. coli expressionDepositorInsertApixaban-Binding Helical Bundle
UseTags6x His-tag and TEV cleavage tagExpressionBacterialMutationPromoterT7Available sinceMarch 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBz118_His_CsoS2
Plasmid#140841PurposeHalothiobacillus neapolitanus CsoS2 with N-terminal His-tag, pET-14b backboneDepositorInsertCsoS2
UseTagsHexahistidine tagExpressionBacterialMutationPromoterT7Available sinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNOC-stacked-GeNL-Ca
Plasmid#101003PurposeConstruct for fusion expression of GeNL calcium reporter and neomycin/G418 resistance gene by a bidirectional promoterDepositorTypeEmpty backboneUseAlgae, nannochloropsis expressionTagsExpressionMutationPromoterAvailable sinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPB_mU6_enh-gRNA_Puro-T2A-BFP
Plasmid#235571PurposeEnhanced guide RNA expression & genomic integration. Target gRNA sequences are cloned in via the BstXI and BlpI sites.DepositorInsertsgRNA backbone
UseCRISPRTagsExpressionMutationPromoterAvailable sinceApril 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLz37_CB_operon_CsoS2_N1-N4
Plasmid#140856PurposeHalothiobacillus neapolitanus carboxysome operon with full length CsoS2. For heterologous expression of carboxysomes in E. coli.DepositorInsertCbbL, CbbS, CsoS2 (full-length), CsoSCA, CsoS4A, CsoS4B, CsoS1C, CsoS1A, CsoS1B, CsoS1D
UseTagsExpressionBacterialMutationPromoterAvailable sinceAug. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBz15_Strep_Rubisco
Plasmid#140839Purposewild-type Halothiobacillus neapolitanus Form I Rubisco with StrepII tag (CbbL-StrepII, CbbS), pET-14b backboneDepositorInsertForm IA Rubisco; CbbL, CbbS
UseTagsStrep IIExpressionBacterialMutationPromoterT7Available sinceJune 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNOC-CRISPR-HA
Plasmid#99370PurposeExpresses Cas9-HA and sgRNA. Hygromycin resistance.DepositorTypeEmpty backboneUseAlgae, nannochloropsis expressionTagsCas9-HAExpressionMutationPromoterRibi promoterAvailable sinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28a-λN-βLac
Plasmid#162039PurposeExpresion of the fusion protein of the λN domain of the λ phage and ampR gene (encoding the enzyme β-lactamase without the native signal sequence)DepositorInsertλN domain of the λ phage and a β-lactamase fusion protein
UseTags6xHis tagExpressionBacterialMutationPromoterT7Available sinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP-Ring1bCD
Plasmid#235574PurposeDox-inducible expression of the catalytic-domain (CD) of epigenetic effector Ring1b fused with scFV to programme H2AK119ub.DepositorInsertRing1b (Rnf2 Mouse)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceApril 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP-Ring1bCD-CatMut
Plasmid#235583PurposeDox-inducible expression of control catalytic-mutant Ring1b CD fused with scFVDepositorInsertRing1b (Rnf2 Mouse)
UseCRISPRTagsExpressionMutationI53SPromoterAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP-Prdm9CD
Plasmid#235577PurposeDox-inducible expression of the catalytic-domain (CD) of epigenetic effector Prdm9 fused with scFV to programme H3K4me3DepositorInsertPrdm9 (Prdm9 Mouse)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceApril 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP-Prdm9CD-CatMut
Plasmid#235586PurposeDox-inducible expression of control catalytic-mutant Prdm9 CD fused with scFVDepositorInsertPrdm9 (Prdm9 Mouse)
UseCRISPRTagsExpressionMutationG282APromoterAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only